BBa_K199005 1 BBa_K199005 RFP with CCACU Addition 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick part E1010. We designed a forward primer that included the first 20 nucleotides on the 5' end, and a reverse primer that included the last 20 nucleotides on the 3' end of the RFP gene. This RFP reporter gene has a 5-base pair CCACU addition after the start codon and before the rest of the gene. This is used in conjunction with the CCACU tRNA (BioBrick part [http://partsregistry.org/Part:BBa_K199002 K199002]). This CCACU tRNA suppresses the frameshift caused by this 5-base pair addition in the reporter. false false _295_ 0 5120 9 It's complicated false We positioned the ATG before the 5-base codon and continued with the rest of the RFP gene. This way, the RBS wouldn't read the reporter gene without reading over the 5-base codon first. In order to ligate our 5-base pair addition at the desired position in the reporter gene, we utilized the restriction enzyme NcoI which cut at a single site 424 bp into the gene. false Shamita Punjabi annotation2006731 1 5 base pair addition range2006731 1 4 8 annotation2013325 1 25 bp addition range2013325 1 687 711 annotation2013714 1 Double Stop range2013714 1 681 686 annotation2006732 1 Nco1 restriction site range2006732 1 424 429 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 BBa_K199095 1 BBa_K199095 pLac-RBS-CCACU-RFP-pTet-CCACU tRNA 2009-10-17T11:00:00Z 2015-05-08T01:11:19Z K199066 + S04279 Reporter construct ligated upstream of a suppressor tRNA. The tRNA suppresses the 5 bp insertion in the RFP gene. false false _295_ 0 5562 9 It's complicated false false Mary Gearing component2052384 1 BBa_K199002 component2052375 1 BBa_K199005 component2052362 1 BBa_R0010 component2052370 1 BBa_B0034 component2052376 1 BBa_R0040 annotation2052384 1 BBa_K199002 range2052384 1 1008 1150 annotation2052375 1 BBa_K199005 range2052375 1 227 937 annotation2052376 1 BBa_R0040 range2052376 1 946 999 annotation2052370 1 BBa_B0034 range2052370 1 209 220 annotation2052362 1 BBa_R0010 range2052362 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K199002 1 BBa_K199002 CCACU tRNA Suppressor (Produces Serine) 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCACU, which would normally cause a frame shift mutation. false false _295_ 0 5109 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCACU. false Shamita Punjabi annotation2006709 1 3' Context range2006709 1 104 143 annotation2006707 1 5' Context range2006707 1 1 11 annotation2006708 1 Anticodon Loop range2006708 1 44 52 BBa_K199002_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199005_sequence 1 atgccactgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199095_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgccactgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z