BBa_K1991004 1 BBa_K1991004 Lpp-OmpA-BamHI 2016-10-09T11:00:00Z 2016-10-12T03:03:40Z Modified based on BBa_K1694002 (Lpp-OmpA-N) Lpp and OmpA are outer membrane proteins of E. coli. Lpp-OmpA (LO) hybrid can direct heterologous proteins to bacterial cell surface. In 2015, NCTU-Formosa used it to display scFv (single chain fragment variable) antibodies on the surface of E. coli. They found that a fusion protein cannot be possible to be created under the standard BioBrick assembly rule, that is EcoRI(E)-XbaI(X)-GENE-SpeI(S)-PstI(P). The A part of EX-LO-SP and the B part of EX-scFV-SP, for example, are connected by cutting and ligation of SpeI plus PstI for the A part and XbaI plus PstI for the B part. The SCAR generated by XbaI/SpeI (ACTAGA) will form a stop codon just in front of the ATG start codon of the scFV protein of the B part. This situation has been officially mentioned by the BioBrick standard assembly. Therefore, in 2015, NCTU-Formosa created a novel part (BBa_K1694002) putting NcoI site between the LO part and SpeI site. However, when considering cloning, we found that an extra NcoI site is present on Cm resistance gene making it difficult be a vector for gene cloning. In 2016, Mingdao improved the part by replacing NcoI site with BamHI site (BBa_K1991004). Also, we???ve confirmed and prove the function of LO directing a fusion protein to the cell surface with enzyme activity in our project. false false _2458_ 31417 31417 9 false BBa_K1991004: Lpp-OmpA-BamHI/pSB1C3 The DNA fragment of Lpp-OmpA was amplified by PCR using BBa_K1694035 as a template with a primer containing BamHI site and digested by EcoRI and SpeI, followed by cloning onto pSB1C3 which was cut by EcoRI and SpeI. The part has been confirmed by sequencing. false Chen, Pei-En annotation2521544 1 OmpA range2521544 1 91 435 annotation2521543 1 linker range2521543 1 88 90 annotation2521542 1 Lpp range2521542 1 1 87 annotation2521545 1 BamHI range2521545 1 436 441 BBa_K1991004_sequence 1 atgaaagcaaccaagctggttctgggtgccgtgattctgggcagtaccctgttagcaggttgttctagcaatgccaaaatcgaccaaggcatcaacaacaatggcccgacccacgaaaaccagctgggtgccggtgcctttggtggttatcaggtgaacccgtacgtgggctttgaaatgggctatgattggctgggccgcatgccgtacaaaggcagtgtggagaacggcgcctataaagcacagggcgtgcagctgacagcaaaactgggctaccctattaccgacgacctggacatctacacacgcttaggcggcatggtgtggcgcgccgataccaagagcaacgtgtacggcaagaaccacgataccggcgtgagtccggtgtttgccggcggtgtggagtatgcaatcaccccggaaattgccacacgtggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z