BBa_K199106 1 BBa_K199106 pLpp promoter 2009-11-18T12:00:00Z 2015-05-08T01:11:20Z The sequence matches that naturally found in E. coli. The lpp promoter is one of the strongest promoters in E. coli. false false _295_ 0 5562 9 Not in stock false n/a false Mary Gearing BBa_K199106_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z