BBa_K199125 1 BBa_K199125 LuxI autoinducer synthetase optimized for E. coli 2010-03-16T12:00:00Z 2015-05-08T01:11:20Z Wild-type LuxI gene optimized for E. coli codon bias using GENEART for gene synthesis. Synthesizes 3OC6HSL, which binds to LuxR. No LVA tag. Directly downstream of the ATG is 21 base pairs translated into 7 amino acids not seen at the beginning of wild-type LuxI (C0161). These base pairs will be mutated from this "optimized wild-type" sequence to become an AsiSI restriction site, a 5 bp-spacer, and an AscI restriction site. These two restriction sites will allow for unique coding sequences to easily be swapped out of the gene. This "optimized wild-type" sequence acts as a positive control before adding in the restriction sites or additional coding sequences. false false _295_ 0 5112 9 Not in stock false The amino acid sequence is the same as wild-type LuxI, but the DNA sequence optimized for Escherichia coli codon bias. 21 base pairs have been added after the start codon (ATG) that will be altered to create two 8-nt restriction enzyme sites and a spacer in order to add in base pairs directly after the start codon. false Olivia Ho-Shing BBa_K199125_sequence 1 atggcaattgcaagcggtcgtgcaaccattatgattaaaaaaagcgattttctggccattccgagcgaagaatataaaggtattctgagcctgcgctatcaggtttttaaacagcgtctggaatgggatctggtggttgaaaataatctggaaagtgatgaatatgataatagcaatgccgaatatatttatgcctgtgatgataccgaaaatgttagcggttgttggcgtctgctgccgaccaccggtgattatatgctgaaaagcgtttttccggaactgctgggtcagcagagcgcaccgaaagatccgaatattgttgaactgagccgttttgccgtgggtaaaaatagcagcaaaattaataatagcgccagcgaaattaccatgaaactgtttgaagccatttataaacatgccgttagccagggtattaccgaatatgttaccgttaccagcaccgcaattgaacgttttctgaaacgtattaaagtgccgtgtcatcgtattggcgataaagaaattcatgttctgggcgataccaaaagcgttgttctgagcatgccgattaatgaacagtttaaaaaagccgtgctgaactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z