BBa_K199125 1 BBa_K199125 LuxI autoinducer synthetase optimized for E. coli 2010-03-16T12:00:00Z 2015-05-08T01:11:20Z Wild-type LuxI gene optimized for E. coli codon bias using GENEART for gene synthesis. Synthesizes 3OC6HSL, which binds to LuxR. No LVA tag. Directly downstream of the ATG is 21 base pairs translated into 7 amino acids not seen at the beginning of wild-type LuxI (C0161). These base pairs will be mutated from this "optimized wild-type" sequence to become an AsiSI restriction site, a 5 bp-spacer, and an AscI restriction site. These two restriction sites will allow for unique coding sequences to easily be swapped out of the gene. This "optimized wild-type" sequence acts as a positive control before adding in the restriction sites or additional coding sequences. false false _295_ 0 5112 9 Not in stock false The amino acid sequence is the same as wild-type LuxI, but the DNA sequence optimized for Escherichia coli codon bias. 21 base pairs have been added after the start codon (ATG) that will be altered to create two 8-nt restriction enzyme sites and a spacer in order to add in base pairs directly after the start codon. false Olivia Ho-Shing BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2047 1 -10 range2047 1 42 47 annotation2048 1 start range2048 1 53 53 annotation2045 1 LuxR/HSL range2045 1 1 20 annotation2046 1 -35 range2046 1 20 25 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K199127 1 BBa_K199127 TT-pLux-RBS-LuxI optimized 2010-03-20T12:00:00Z 2015-05-08T01:11:20Z From the BioBrick parts registry and LuxI optimized synthesized de novo Insulated generator for LuxI (no LVA tag), sequence optimized for E. coli false false _295_ 0 5112 9 Not in stock false In pSB1A2. See details for LuxI optimized for more. false Olivia Ho-Shing component2067412 1 BBa_B0034 component2067400 1 BBa_B0010 component2067413 1 BBa_K199125 component2067407 1 BBa_R0062 component2067402 1 BBa_B0012 annotation2067400 1 BBa_B0010 range2067400 1 1 80 annotation2067402 1 BBa_B0012 range2067402 1 89 129 annotation2067407 1 BBa_R0062 range2067407 1 138 192 annotation2067412 1 BBa_B0034 range2067412 1 201 212 annotation2067413 1 BBa_K199125 range2067413 1 219 824 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_K199125_sequence 1 atggcaattgcaagcggtcgtgcaaccattatgattaaaaaaagcgattttctggccattccgagcgaagaatataaaggtattctgagcctgcgctatcaggtttttaaacagcgtctggaatgggatctggtggttgaaaataatctggaaagtgatgaatatgataatagcaatgccgaatatatttatgcctgtgatgataccgaaaatgttagcggttgttggcgtctgctgccgaccaccggtgattatatgctgaaaagcgtttttccggaactgctgggtcagcagagcgcaccgaaagatccgaatattgttgaactgagccgttttgccgtgggtaaaaatagcagcaaaattaataatagcgccagcgaaattaccatgaaactgtttgaagccatttataaacatgccgttagccagggtattaccgaatatgttaccgttaccagcaccgcaattgaacgttttctgaaacgtattaaagtgccgtgtcatcgtattggcgataaagaaattcatgttctgggcgataccaaaagcgttgttctgagcatgccgattaatgaacagtttaaaaaagccgtgctgaactaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K199127_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaatactagatggcaattgcaagcggtcgtgcaaccattatgattaaaaaaagcgattttctggccattccgagcgaagaatataaaggtattctgagcctgcgctatcaggtttttaaacagcgtctggaatgggatctggtggttgaaaataatctggaaagtgatgaatatgataatagcaatgccgaatatatttatgcctgtgatgataccgaaaatgttagcggttgttggcgtctgctgccgaccaccggtgattatatgctgaaaagcgtttttccggaactgctgggtcagcagagcgcaccgaaagatccgaatattgttgaactgagccgttttgccgtgggtaaaaatagcagcaaaattaataatagcgccagcgaaattaccatgaaactgtttgaagccatttataaacatgccgttagccagggtattaccgaatatgttaccgttaccagcaccgcaattgaacgttttctgaaacgtattaaagtgccgtgtcatcgtattggcgataaagaaattcatgttctgggcgataccaaaagcgttgttctgagcatgccgattaatgaacagtttaaaaaagccgtgctgaactaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z