BBa_K199048 1 BBa_K199048 CCACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUGGUGGAA 3'so that the anticodon GGUGG could be used to decode a frameshift mutation of CCACC in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011945 1 5nt anti codon range2011945 1 46 50 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961222 1 BBa_R0010 range1961222 1 1 200 BBa_K199134 1 BBa_K199134 pLac+CCAAU tRNA+CCACC tRNA 2010-03-29T11:00:00Z 2015-05-08T01:11:20Z biobrick part and oligos pLac promoter plus CCAAU tRNA plus CCACC tRNA false false _295_ 0 5113 9 It's complicated false NA false Bryce Szczepanik component2067499 1 BBa_R0010 component2067507 1 BBa_K199047 component2067509 1 BBa_K199048 annotation2067507 1 BBa_K199047 range2067507 1 209 351 annotation2067499 1 BBa_R0010 range2067499 1 1 200 annotation2067509 1 BBa_K199048 range2067509 1 360 502 BBa_K199047 1 BBa_K199047 CCAAU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUAUUGGAC 3'so that the anticodon AUUGG could be used to decode a frameshift mutation of CCAAU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011944 1 5nt anti codon range2011944 1 46 50 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199047_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199134_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199048_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z