BBa_K199177 1 BBa_K199177 pLac+tRNA CCAAU+pLac+tRNA CUAGC 2010-07-15T11:00:00Z 2015-05-08T01:11:21Z BioBricks pLac+tRNA CCAAU+pLac+tRNA CUAGC false false _295_ 0 5111 9 It's complicated false N/A false Eric Sawyer component2074027 1 BBa_K199047 component2074019 1 BBa_R0010 component2074028 1 BBa_R0010 component2074036 1 BBa_K199016 annotation2074027 1 BBa_K199047 range2074027 1 209 351 annotation2074036 1 BBa_K199016 range2074036 1 568 710 annotation2074028 1 BBa_R0010 range2074028 1 360 559 annotation2074019 1 BBa_R0010 range2074019 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K199016 1 BBa_K199016 CUAGC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUGCUAGAA 3'so that the anticodon GCUAG could be used to decode a frameshift mutation of CUAGC in a mRNA. false false _295_ 0 5118 9 It's complicated false none false Clifton Davis annotation2007936 1 5 nt anitcodon range2007936 1 46 50 BBa_K199047 1 BBa_K199047 CCAAU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUAUUGGAC 3'so that the anticodon AUUGG could be used to decode a frameshift mutation of CCAAU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011944 1 5nt anti codon range2011944 1 46 50 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199016_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199047_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199177_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z