BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_K199186 1 BBa_K199186 pLac+tRNA CCAAU+pLac+tRNA CUAGC+pLac+tRNA CUACU 2010-07-20T11:00:00Z 2015-05-08T01:11:21Z BioBricks pLac+tRNA CCAAU+pLac+tRNA CUAGC+pLac+tRNA CUACU false false _295_ 0 5111 9 It's complicated false N/A false Eric Sawyer component2074909 1 BBa_K199016 component2074900 1 BBa_K199047 component2074918 1 BBa_K199046 component2074910 1 BBa_R0010 component2074901 1 BBa_R0010 component2074892 1 BBa_R0010 annotation2074910 1 BBa_R0010 range2074910 1 719 918 annotation2074918 1 BBa_K199046 range2074918 1 927 1069 annotation2074901 1 BBa_R0010 range2074901 1 360 559 annotation2074909 1 BBa_K199016 range2074909 1 568 710 annotation2074900 1 BBa_K199047 range2074900 1 209 351 annotation2074892 1 BBa_R0010 range2074892 1 1 200 BBa_K199016 1 BBa_K199016 CUAGC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUGCUAGAA 3'so that the anticodon GCUAG could be used to decode a frameshift mutation of CUAGC in a mRNA. false false _295_ 0 5118 9 It's complicated false none false Clifton Davis annotation2007936 1 5 nt anitcodon range2007936 1 46 50 BBa_K199047 1 BBa_K199047 CCAAU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUAUUGGAC 3'so that the anticodon AUUGG could be used to decode a frameshift mutation of CCAAU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011944 1 5nt anti codon range2011944 1 46 50 BBa_K199046 1 BBa_K199046 CUACU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUAGUAGAU 3'so that the anticodon AGUAG could be used to decode a frameshift mutation of CUACU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011943 1 5nt anti codon range2011943 1 46 50 BBa_K199186_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtttagtagataccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199046_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttagtagataccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199016_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199047_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z