BBa_K199046 1 BBa_K199046 CUACU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUAGUAGAU 3'so that the anticodon AGUAG could be used to decode a frameshift mutation of CUACU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011943 1 5nt anti codon range2011943 1 46 50 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_K199014 1 BBa_K199014 AGGAC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Synthesized from oligonucleotides and sequence verified. A serine tRNA was modified to have the anticodon loop 5' CUGUCCUAA 3'so that the anticodon GUCCA could be used to decode a frameshift mutation of AGGAC in a mRNA. false false _295_ 0 5115 9 It's complicated false None. false William Vernon annotation2007934 1 5 nt anticodon range2007934 1 46 50 BBa_K199048 1 BBa_K199048 CCACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUGGUGGAA 3'so that the anticodon GGUGG could be used to decode a frameshift mutation of CCACC in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011945 1 5nt anti codon range2011945 1 46 50 BBa_K199188 1 BBa_K199188 pLac+tRNA CCACC+pLac+tRNA AGGAC+pLac+tRNA CUACU 2010-07-20T11:00:00Z 2015-05-08T01:11:21Z BioBricks pLac+tRNA CCACC+pLac+tRNA AGGAC+pLac+tRNA CUACU false false _295_ 0 5111 9 It's complicated false N/A false Eric Sawyer component2074954 1 BBa_K199048 component2074946 1 BBa_R0010 component2074964 1 BBa_R0010 component2074972 1 BBa_K199046 component2074963 1 BBa_K199014 component2074955 1 BBa_R0010 annotation2074972 1 BBa_K199046 range2074972 1 927 1069 annotation2074963 1 BBa_K199014 range2074963 1 568 710 annotation2074954 1 BBa_K199048 range2074954 1 209 351 annotation2074955 1 BBa_R0010 range2074955 1 360 559 annotation2074946 1 BBa_R0010 range2074946 1 1 200 annotation2074964 1 BBa_R0010 range2074964 1 719 918 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199046_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttagtagataccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199188_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgtcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtttagtagataccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199014_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgtcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199048_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z