BBa_K199016 1 BBa_K199016 CUAGC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUGCUAGAA 3'so that the anticodon GCUAG could be used to decode a frameshift mutation of CUAGC in a mRNA. false false _295_ 0 5118 9 It's complicated false none false Clifton Davis annotation2007936 1 5 nt anitcodon range2007936 1 46 50 BBa_K199048 1 BBa_K199048 CCACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUGGUGGAA 3'so that the anticodon GGUGG could be used to decode a frameshift mutation of CCACC in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011945 1 5nt anti codon range2011945 1 46 50 BBa_K199045 1 BBa_K199045 CUACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Assembly from oligos A serine tRNA was modified to have the anticodon loop 5' GUGGUAGAA 3'so that the anticodon GGUAG could be used to decode a frameshift mutation of CUACC in a mRNA. false false _295_ 0 5115 9 It's complicated false NO false William Vernon annotation2011866 1 5nt anti codon range2011866 1 46 50 BBa_K199189 1 BBa_K199189 pLac+tRNA CCACC+pLac+tRNA CUAGC+pLac+tRNA CUACC 2010-07-20T11:00:00Z 2015-05-08T01:11:21Z BioBricks pLac+tRNA CCACC+pLac+tRNA CUAGC+pLac+tRNA CUACC false false _295_ 0 5111 9 It's complicated false N/A false Eric Sawyer component2074991 1 BBa_R0010 component2074973 1 BBa_R0010 component2074999 1 BBa_K199045 component2074981 1 BBa_K199048 component2074990 1 BBa_K199016 component2074982 1 BBa_R0010 annotation2074981 1 BBa_K199048 range2074981 1 209 351 annotation2074973 1 BBa_R0010 range2074973 1 1 200 annotation2074999 1 BBa_K199045 range2074999 1 927 1069 annotation2074982 1 BBa_R0010 range2074982 1 360 559 annotation2074991 1 BBa_R0010 range2074991 1 719 918 annotation2074990 1 BBa_K199016 range2074990 1 568 710 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961227 1 start range1961227 1 173 173 BBa_K199045_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtgtggtagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199189_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtgtggtagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199016_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199048_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z