BBa_K199014 1 BBa_K199014 AGGAC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Synthesized from oligonucleotides and sequence verified. A serine tRNA was modified to have the anticodon loop 5' CUGUCCUAA 3'so that the anticodon GUCCA could be used to decode a frameshift mutation of AGGAC in a mRNA. false false _295_ 0 5115 9 It's complicated false None. false William Vernon annotation2007934 1 5 nt anticodon range2007934 1 46 50 BBa_K199192 1 BBa_K199192 pLac+tRNA CCAAU+pLac+tRNA AGGAC+pLac+tRNA CUACC 2010-07-21T11:00:00Z 2015-05-08T01:11:21Z BioBricks pLac+tRNA CCAAU+pLac+tRNA AGGAC+pLac+tRNA CUACC false false _295_ 0 5111 9 It's complicated false N/A false Eric Sawyer component2075389 1 BBa_R0010 component2075371 1 BBa_R0010 component2075380 1 BBa_R0010 component2075379 1 BBa_K199047 component2075388 1 BBa_K199014 component2075397 1 BBa_K199045 annotation2075389 1 BBa_R0010 range2075389 1 719 918 annotation2075380 1 BBa_R0010 range2075380 1 360 559 annotation2075388 1 BBa_K199014 range2075388 1 568 710 annotation2075371 1 BBa_R0010 range2075371 1 1 200 annotation2075397 1 BBa_K199045 range2075397 1 927 1069 annotation2075379 1 BBa_K199047 range2075379 1 209 351 BBa_K199045 1 BBa_K199045 CUACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Assembly from oligos A serine tRNA was modified to have the anticodon loop 5' GUGGUAGAA 3'so that the anticodon GGUAG could be used to decode a frameshift mutation of CUACC in a mRNA. false false _295_ 0 5115 9 It's complicated false NO false William Vernon annotation2011866 1 5nt anti codon range2011866 1 46 50 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961227 1 start range1961227 1 173 173 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961224 1 -35 range1961224 1 137 142 BBa_K199047 1 BBa_K199047 CCAAU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUAUUGGAC 3'so that the anticodon AUUGG could be used to decode a frameshift mutation of CCAAU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011944 1 5nt anti codon range2011944 1 46 50 BBa_K199045_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtgtggtagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199192_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgtcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggatccaattcggagagatgccggagcggctgaacggaccggtgtggtagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K199047_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199014_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgtcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z