BBa_K1994015 1 BBa_K1994015 sgRNA with 5' golden gate adapter and COM protein binding site 2016-09-25T11:00:00Z 2016-10-19T01:28:04Z synthetic For use in CRISPR/Cas9 systems. Contains golden gate adapter at 5' end for inserting target sequence. Contains a COM protein binding site in the middle. false false _2461_ 30870 27126 9 false No special considerations false Liam Carroll annotation2484929 1 dCas9 handle range2484929 1 21 62 annotation2484930 1 truncated S. pyrogenes terminator range2484930 1 63 96 annotation2484931 1 10bp linker range2484931 1 97 106 annotation2484932 1 COM handle range2484932 1 107 125 annotation2484928 1 20nt golden gate adapter range2484928 1 1 20 annotation2484933 1 10bp linker range2484933 1 126 135 annotation2484934 1 aspA terminator range2484934 1 136 176 BBa_K1994015_sequence 1 agagaccactttcggtctctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaccaataccactgaatgcctgcgagcatcaccaataccaacaagaaaaaaggcacgtcatctgacgtgccttttttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z