BBa_K1994016 1 BBa_K1994016 sgRNA with 5' golden gate adapter and MS2 coat protein binding site 2016-09-25T11:00:00Z 2016-10-19T01:26:31Z Synthetic For use in CRISPR/Cas9 systems. Contains golden gate adapter at 5' end for inserting target sequence. Contains a MS2 coat protein binding site in the middle. false false _2461_ 30870 27126 9 false No special considerations false Liam Carroll annotation2484938 1 5bp linker range2484938 1 97 101 annotation2484940 1 5bp linker range2484940 1 127 131 annotation2484939 1 MS2 handle range2484939 1 102 126 annotation2484941 1 aspA terminator range2484941 1 132 172 annotation2484936 1 dCas9 handle range2484936 1 21 62 annotation2484937 1 truncated S. pyrogenes terminator range2484937 1 63 96 annotation2484935 1 20nt golden gate adapter range2484935 1 1 20 BBa_K1994016_sequence 1 agagaccactttcggtctctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcacaaagcgcacatgaggattacccatgtgcacccaacaagaaaaaaggcacgtcatctgacgtgccttttttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z