BBa_K1994019 1 BBa_K1994019 Multiple dCas9 binding site sequence 2016-09-25T11:00:00Z 2016-10-19T03:50:49Z Escherichia coli Promoter sequence containing multiple PAMs staggered at regular intervals to provide multiple possible sites for dCas9 binding. false false _2461_ 30870 27126 9 true No special considerations false Liam Carroll annotation2522793 1 Multiple dCas9 binding sites range2522793 1 7 210 annotation2522794 1 30nt dCas9 spacer range2522794 1 210 239 BBa_K1994019_sequence 1 agagtgggacgaaataggtatgaaacggagtgaagtggagagcgaaggataaacacggaaatagaaggtgaggtaaggatgaatgaggcaaattagggacatatgcggtaagtgtaggtgaaagtgggatgataaaggttgagtacggcgagattaggatatttagggcaagtataggtaaacgaaggctaagaatggaatgagagaggatgattatcgttgttgctagccggcgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z