BBa_K1994021 1 BBa_K1994021 sgRNA containing two golden gate adapters 2016-10-13T11:00:00Z 2016-10-19T08:03:43Z Synthetic modification of crRNA and tracrRNA found in S. pyrogenes sgRNA with Bsa 1 Golden Gate adaptors false false _2461_ 30870 30870 9 true To simplify the traditional gRNA comprised of a crRNA containing a dCas9 handle, and tracrRNA which binds to the PAM sequence in CRISPR, we created a joined sgRNA. As modifying the 3' end of the gRNA does not affect dCas9 binding we have used a deactivated dcas9 terminator and placed golden gate adaptable sites. The two sites are located where the complementary PAM-proximal sequence is located, allowing the distance dCas9 binds from the promoter to be adapted.The other golden gate adaptor in the position after the deactivated terminator so any RNA sequence such as an RNA binding protein handle can be inserted. This region is then followed by a real terminator for the strand. false Isobel Holden annotation2503090 1 aspA terminator range2503090 1 116 157 annotation2503036 1 deactivated dCas9 terminator range2503036 1 63 96 annotation2502949 1 Golden Gate adaptor range2502949 1 1 20 annotation2503015 1 dCas9 handle range2503015 1 21 62 annotation2503056 1 Golden Gate adaptor range2503056 1 97 116 BBa_K1994021_sequence 1 agagaccactttcggtctctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctgagaccgtacccggtctctacaagaaaaaaggcacgtcatctgacgtgccttttttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z