BBa_K1994028 1 BBa_K1994028 sgRNA with PAM Proximal complementary sequence and Com binding protein handle 2016-10-13T11:00:00Z 2016-10-19T06:13:13Z sgRNA with PAM Proximal complementary sequence and Com binding protein handle sgRNA with PAM Proximal complementary sequence and Com binding protein handle false false _2461_ 30870 28134 9 false sgRNA with PAM Proximal complementary sequence and Com binding protein handle false Egheosa Ogbomo annotation2524186 1 truncated s.pyrogenes terminator range2524186 1 63 97 annotation2524187 1 10bp spacer range2524187 1 98 108 annotation2524185 1 dCas9 handle range2524185 1 20 62 annotation2524184 1 Golden Gate adaptor range2524184 1 1 20 annotation2524190 1 aspA terminator range2524190 1 140 177 annotation2524189 1 10bp spacer range2524189 1 129 139 annotation2524188 1 Com BP handle range2524188 1 109 128 BBa_K1994028_sequence 1 agagaccactttcggtctctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaccaataccactgaatgcctgcgagcatcaccaataccaacaagaaaaaaggcacgtcatctgacgtgccttttttattta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z