BBa_K1994031 1 BBa_K1994031 sgRNA with PAM Proximal complementary sequence and MS2 binding protein handle 2016-10-13T11:00:00Z 2016-10-19T05:31:16Z sgRNA with PAM Proximal complementary sequence and MS2 binding protein handle sgRNA with PAM Proximal complementary sequence and MS2 binding protein handle false false _2461_ 30870 28134 9 false sgRNA with PAM Proximal complementary sequence and MS2 binding protein handle false Egheosa Ogbomo annotation2524180 1 10bp linker range2524180 1 136 146 annotation2523750 1 dCas9 handle range2523750 1 21 63 annotation2524191 1 aspA terminator range2524191 1 147 223 annotation2524178 1 MS2 BP handle range2524178 1 110 135 annotation2523745 1 Golden Gate range2523745 1 1 20 annotation2523797 1 truncated S.pyrogenes terminator range2523797 1 64 98 annotation2523809 1 10bp linker range2523809 1 99 109 BBa_K1994031_sequence 1 ctagattgacagctagctcagtcctaggtataatgctagcagagaccactttcggtctctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcacccaacaaagcgcacatgaggattacccatgtgcacccaacaaaacaagaaaaaaggcacgtcatctgacgtgccttttttattta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z