BBa_K1994032 1 BBa_K1994032 Multiple dCas9 binding sites with weak Sigma 54 promoter 2016-10-13T11:00:00Z 2016-10-19T07:13:46Z dCas9 with Pam staggered sequence and sigma 54 promoter dCas9 with Pam staggered sequence and sigma 54 promoter false false _2461_ 30870 28134 9 false dCas9 with Pam staggered sequence and sigma 54 promoter false Egheosa Ogbomo component2523827 1 BBa_K1994033 component2523823 1 BBa_K1994019 annotation2523823 1 BBa_K1994019 range2523823 1 1 239 annotation2523827 1 BBa_K1994033 range2523827 1 248 293 BBa_K1994019 1 BBa_K1994019 Multiple dCas9 binding site sequence 2016-09-25T11:00:00Z 2016-10-19T03:50:49Z Escherichia coli Promoter sequence containing multiple PAMs staggered at regular intervals to provide multiple possible sites for dCas9 binding. false false _2461_ 30870 27126 9 true No special considerations false Liam Carroll annotation2522794 1 30nt dCas9 spacer range2522794 1 210 239 annotation2522793 1 Multiple dCas9 binding sites range2522793 1 7 210 BBa_K1994033 1 BBa_K1994033 Weakened Sigma54 Promoter 2016-10-13T11:00:00Z 2016-10-19T08:09:23Z Weakened Sigma54 Promoter Weakened Sigma54 Promoter false false _2461_ 30870 28134 9 false Weakened Sigma54 Promoter false Isobel Holden annotation2522810 1 Sal I range2522810 1 41 46 annotation2522795 1 Weak Sigma 54 range2522795 1 7 40 annotation2522753 1 Bgl II range2522753 1 1 6 BBa_K1994032_sequence 1 agagtgggacgaaataggtatgaaacggagtgaagtggagagcgaaggataaacacggaaatagaaggtgaggtaaggatgaatgaggcaaattagggacatatgcggtaagtgtaggtgaaagtgggatgataaaggttgagtacggcgagattaggatatttagggcaagtataggtaaacgaaggctaagaatggaatgagagaggatgattatcgttgttgctagccggcgtggatactagagagatctttgacagctagctcagtcctagggattgtgctaggtcgac BBa_K1994019_sequence 1 agagtgggacgaaataggtatgaaacggagtgaagtggagagcgaaggataaacacggaaatagaaggtgaggtaaggatgaatgaggcaaattagggacatatgcggtaagtgtaggtgaaagtgggatgataaaggttgagtacggcgagattaggatatttagggcaagtataggtaaacgaaggctaagaatggaatgagagaggatgattatcgttgttgctagccggcgtgga BBa_K1994033_sequence 1 agatctttgacagctagctcagtcctagggattgtgctaggtcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z