BBa_K1994041 1 BBa_K1994041 sgRNA with dCas9 binding site Sequence 3 with PP7 handle insert 2016-10-13T11:00:00Z 2016-10-19T07:32:17Z sgRNA with PAM-Proximal complementary sequence 2 sgRNA with PAM-Proximal complementary sequence 2 false false _2461_ 30870 28134 9 false sgRNA with PAM-Proximal complementary sequence 2 false Egheosa Ogbomo annotation2523765 1 Golden Gate adaptor range2523765 1 1 20 annotation2523805 1 deactivated dCas9 terminator range2523805 1 63 97 annotation2523798 1 dCas9 Handle range2523798 1 20 62 BBa_K1994041_sequence 1 gggcaagtataggtaaacgagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcacccaacaaaaacataaggagtttatatggaaacccttatgacccaacaaaacaagaaaaaaggcacgtcatctgacgtgccttttttattta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z