BBa_K1994043 1 BBa_K1994043 Truncated B0010 terminator 2016-10-13T11:00:00Z 2016-10-19T05:01:30Z sgRNA with PAM-Proximal complementary sequence 4 sgRNA with PAM-Proximal complementary sequence 4 false false _2461_ 30870 28134 9 false sgRNA with PAM-Proximal complementary sequence 4 false Egheosa Ogbomo annotation2522943 1 Stop codons range2522943 1 1 7 annotation2522946 1 B0010 terminator range2522946 1 15 33 BBa_K1994043_sequence 1 tgataagcggccgaccaggcatcaaataaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z