BBa_K1994045 1 BBa_K1994045 T7 terminator SBa_000587 2016-10-13T11:00:00Z 2016-10-19T12:31:38Z sgRNA with PAM-Proximal complementary sequence 6 sgRNA with PAM-Proximal complementary sequence 6 false false _2461_ 30870 28134 9 false sgRNA with PAM-Proximal complementary sequence 6 false Egheosa Ogbomo annotation2521969 1 Spacer range2521969 1 53 57 annotation2521968 1 T7 Terminator range2521968 1 4 52 annotation2521935 1 spacer range2521935 1 1 3 BBa_K1994045_sequence 1 taatactcgaacccctagcccgctcttatcgggcggctaggggttttttgtcctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z