BBa_K1997001 1 BBa_K1997001 sHRP-C 2016-10-12T11:00:00Z 2016-10-13T01:07:07Z It was custom synthesized. The original sequence was from Armoracia rusticana This is the C terminal of split HRP reporter. It can be used for protein-protein interaction research. false false _2464_ 21134 21134 9 false Two 10aa linkers were added on both sides of the CDS, sequence were codon optimized for expression in E.coli. false Xinyuan Qiu annotation2496404 1 10aa linker range2496404 1 1 30 annotation2496405 1 sHRP-C range2496405 1 31 315 annotation2496407 1 10aa linker range2496407 1 316 345 BBa_K1997001_sequence 1 aaaggttctggttctacctctggttctggtaacctcagtgcactggtggactttgatctgcggaccccaaccatcttcgataacaagtactatgtgaatttagaagagcagaaaggcctgatacagagtgatcaagaactgtttagcagtccagatgccactgacaccatcccactggtgagaagttttgctaactctactcaaaccttctttaacgccttcgtggaagccatggaccgtatgggtaacattacccctctgacgggtacccaaggccagattcgtcgcaactgtagagtggtcaacagcaactctaaaggttctggttctacctctggttctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z