BBa_K200002 1 ygiV Colanic acid global regulator -> ygiV (B3023) 2009-08-11T11:00:00Z 2015-05-08T01:11:21Z NCBI Reference Sequence: NC_000913.2 >gi|49175990:3166771-3167253 Escherichia coli str. K-12 substr. MG1655, complete genome The putative transcription factor B3023 acts as a repressor for the yncC promoter. YncC increases biofilm formation by repressing overproduction of the exopolysaccharide identified as colanic acid. Therefore B3023 increases the production of colanic acid by blocking YncC. false false _298_ 0 5277 9 It's complicated false The sequence of NCBI is the reverse compliment. false James Field annotation2027405 1 stop range2027405 1 484 486 annotation2018132 1 stop range2018132 1 481 483 annotation2018131 1 cds range2018131 1 1 480 annotation2018130 1 start range2018130 1 1 3 BBa_K200002_sequence 1 atgacaaacctgacactggatgtaaacattatcgatttcccatcaatacctgtggcgatgttgccgcaccgctgtagccctgaattgctcaactacagcgtggcgaaatttatcatgtggcgtaaagagacggggctttctcctgttaaccaaagccagacttttggcgtcgcctgggacgaccctgccaccaccgcaccggaagcgtttcgctttgatatctgcggcagcgttagcgaaccgattcccgataatcgttatggtgtgagcaatggtgaacttaccggtggacgttatgccgtggcccgccacgttggcgagctggacgatatttcacacacggtatggggcatcattcgccactggctgcctgcaagcggcgagaaaatgcgtaaagcaccgattctgtttcactacaccaatcttgccgaaggggtgacagagcagcgactggaaacggatgtttatgtgccgttggcgtgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z