BBa_K200004 1 BBa_K200004 TaqI 2009-08-11T11:00:00Z 2015-05-08T01:11:21Z This is one of three site-specific DNA methylases found in most laboratory strains of E. coli. The methylase encoded by the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine to the N6 position of the adenine residues in the sequence GATC. When methylation occurs in the recognition site of a particular group of restriction endonuclease including MboI, this protects the DNA from cleavage. false false _298_ 0 5263 9 Not in stock false None false Dineka Khurmi, Royah Vaezi BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K200010 1 BBa_K200010 TaqI Composite 2009-08-11T11:00:00Z 2015-05-08T01:11:21Z E-coli This sequence codes for the restriction enzyme TaqI. This enzyme is Dam methylation sensitive. <br><br> The recognition sequence is TCGA. TaqI is a 4 base cutting enzyme, leaving a 2 base overhang.<br> The cutting site is as shown:<br><br> TCGA -> T CGA<br> AGCT -> AGC T false false _298_ 0 5275 9 Not in stock false Dam Sensitive false David Roche, Royah Vaezi component2059382 1 BBa_B0012 component2059378 1 BBa_B0034 component2059380 1 BBa_B0010 component2059379 1 BBa_K200004 annotation2059382 1 BBa_B0012 range2059382 1 895 935 annotation2059379 1 BBa_K200004 range2059379 1 19 798 annotation2059380 1 BBa_B0010 range2059380 1 807 886 annotation2059378 1 BBa_B0034 range2059378 1 1 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K200010_sequence 1 aaagaggagaaatactagatgaaagagccgctgaaagatctgcaacgtttccgtgacttcctgagcagcattccactggacaaatatcgtgaggagctgaaaaacatcaaatgggtcgagcaagacctgccaaaagaaattctgccactgtcctccatcttccgctattattgggaagagcgtaactttctgaacttcgaggagtggtttgaaaacttctggcaacacattaacaacaaccaggagagcaaacgcgcgctggaggatttcaaaaaatattatttcaaccgtgacctgggcgaaaatgattggttcaaaaaaggcttcaaagcccgtatgtatcgtacatgggtgtcagttctgactcaactggacttctgttatctgttcgagtatatctgtgacaaagagtccaaaaacctgaaactggagtgtaacagcgaactggaccgtaaaggcattgatgcccgtgtgaacgaaatcaacttccagattgctaaaatcacacagcgtaaagaagcacgttcagcctctaaaaaaaaatccctgatcacaatcccttatgccgtgttcaacctggaggattttgagcgtaaaatcggcagcaaacgtgtgaaagacaaaaccggctatcagaatagcctggaggcgtttaaaaaatatttcatccgcctgaataacggcttcgtggtgtttcacgagaactatctgcgcaccatcatcgagaacattagcgacatcgaaaaactgaaaaaagtggtggaagagattagccgtgaactggctggaggttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K200004_sequence 1 atgaaagagccgctgaaagatctgcaacgtttccgtgacttcctgagcagcattccactggacaaatatcgtgaggagctgaaaaacatcaaatgggtcgagcaagacctgccaaaagaaattctgccactgtcctccatcttccgctattattgggaagagcgtaactttctgaacttcgaggagtggtttgaaaacttctggcaacacattaacaacaaccaggagagcaaacgcgcgctggaggatttcaaaaaatattatttcaaccgtgacctgggcgaaaatgattggttcaaaaaaggcttcaaagcccgtatgtatcgtacatgggtgtcagttctgactcaactggacttctgttatctgttcgagtatatctgtgacaaagagtccaaaaacctgaaactggagtgtaacagcgaactggaccgtaaaggcattgatgcccgtgtgaacgaaatcaacttccagattgctaaaatcacacagcgtaaagaagcacgttcagcctctaaaaaaaaatccctgatcacaatcccttatgccgtgttcaacctggaggattttgagcgtaaaatcggcagcaaacgtgtgaaagacaaaaccggctatcagaatagcctggaggcgtttaaaaaatatttcatccgcctgaataacggcttcgtggtgtttcacgagaactatctgcgcaccatcatcgagaacattagcgacatcgaaaaactgaaaaaagtggtggaagagattagccgtgaactggctggaggttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z