BBa_K200014 1 BBa_K200014 Opiorphin + EK cleavage site + His Tag 2009-10-12T11:00:00Z 2015-05-08T01:11:21Z Synthetic sequence. Released HQ 2013 This part codes for the pentapeptide opiorphin. An enterokinase cleavage site and HIS tag have been included for purification purposes. false false _298_ 0 5277 9 In stock true The cleavable linker facilitiates the synthesis of this pentapeptide as it does not begin with the amino acid methionine. false James Field BBa_K200014_sequence 1 atgcaccaccaccaccaccacgacgacgacaaacagcgtttctctcgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z