BBa_K200016 1 BBa_K200016 Temperature Sensitive Lambda cI Repressor 2009-10-13T11:00:00Z 2015-05-08T01:11:21Z pGW7 plasmid from ATCC The temperature sensitive lamda cI repressor protein has a cI857 mutation that results in denaturation of the repressor when the temperature is raised from 30 to 42??C, thereby allowing lambda promoter expression. The repressor normally negatively regulates the expression of genes from the bacteriophage lambda pL and pR promoters. This repressive action is strongest at 30??C. However, when the temperature is raised, typically to 42??C, the functionality of the protein is lost and the cI repressor is no longer able to bind to the operators on its promoter. Therefore, lambda promoter expression increases. The coding region is part of the BBa_K200011 composite as part of the genomic deletion module of The E.ncapsulator by Imperial College's 2009 iGEM team. false false _298_ 0 5155 9 Not in stock false N/A false Royah Vaezi BBa_K200016_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z