BBa_K118011 1 BBa_K118011 PcstA (glucose-repressible promoter) 2008-08-18T11:00:00Z 2015-05-08T01:09:36Z ''Eschaerichia coli'' JM109 genomic DNA Released HQ 2013 This is the promoter for the ''Eschaerichia coli'' JM109 ''cstA'' gene. It includes the CRP-binding site and the RNA polymerase-binding site. Low glucose concentration results in increased activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to associate with the promoter and promote transcription of the downstream gene. (''cstA'' encodes the carbon starvation protein.) false true _192_ 0 3282 9 In stock true No special considerations true Andrew Hall annotation1972435 1 cAMP receptor protein binding site range1972435 1 1 42 annotation1972436 1 RNA polymerase binding site range1972436 1 101 131 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K200000 1 RcsB Colanic acid global regulator -> RcsB 2009-08-11T11:00:00Z 2015-05-08T01:11:21Z NCBI Reference Sequence: NC_000913.2 >gi|49175990:2314199-2314849 Released HQ 2013 RcsB is a receiver protein in a two component phosphorelay system. Up-regulation of RcsB has been shown to induce colanic acid production. This is via the activation of the ugd operon which is required for capsule synthesis. false false _298_ 0 5277 9 In stock true RcsB also upregulates ftsZ which increases the rate of cell division. false James Field annotation2041560 1 stop range2041560 1 649 653 annotation2041559 1 start range2041559 1 1 3 annotation2041558 1 RcsB gene range2041558 1 1 648 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K200025 1 BBa_K200025 pCstA+RBS+RcsB+TT 2009-10-14T11:00:00Z 2015-05-08T01:11:21Z From existing parts For the production or colanic acid false false _298_ 0 5155 9 Not in stock true N/A false Royah Vaezi component2058648 1 BBa_B0034 component2058652 1 BBa_K200000 component2058655 1 BBa_B0012 component2058653 1 BBa_B0010 component2058646 1 BBa_K118011 annotation2058652 1 BBa_K200000 range2058652 1 158 811 annotation2058646 1 BBa_K118011 range2058646 1 1 131 annotation2058653 1 BBa_B0010 range2058653 1 820 899 annotation2058648 1 BBa_B0034 range2058648 1 140 151 annotation2058655 1 BBa_B0012 range2058655 1 908 948 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K118011_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggaca BBa_K200000_sequence 1 atgaacaatatgaacgtaattattgccgatgaccatccgatagtcttgttcggtattcgcaaatcacttgagcaaattgagtgggtgaatgttgtcggcgaatttgaagactctacagcactgatcaacaacctgccgaaactggatgcgcatgtgttgattaccgatctctccatgcctggcgataagtacggcgatggcattaccttaatcaagtacatcaagcgccatttcccaagcctgtcgatcattgttctgactatgaacaacaacccggcgattcttagtgcggtattggatctggatatcgaagggatcgtgctgaaacaaggtgcaccgaccgatctgccgaaagctctcgccgcgctccagaaagggaagaaatttaccccggaaagcgtttctcgcctgttggaaaaaatcagtgctggtggttacggtgacaagcgtctctcgccaaaagagagtgaagttctgcgcctgtttgcggaaggcttcctggtgaccgagatcgctaaaaagctgaaccgcagtattaaaaccatcagtagccagaagaaatctgcgatgatgaagctgggtgtcgagaacgatatcgccctgctgaattatctctcttcagtgaccttaagtccggcagataaagactaataa BBa_K200025_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggacatactagagaaagaggagaaatactagatgaacaatatgaacgtaattattgccgatgaccatccgatagtcttgttcggtattcgcaaatcacttgagcaaattgagtgggtgaatgttgtcggcgaatttgaagactctacagcactgatcaacaacctgccgaaactggatgcgcatgtgttgattaccgatctctccatgcctggcgataagtacggcgatggcattaccttaatcaagtacatcaagcgccatttcccaagcctgtcgatcattgttctgactatgaacaacaacccggcgattcttagtgcggtattggatctggatatcgaagggatcgtgctgaaacaaggtgcaccgaccgatctgccgaaagctctcgccgcgctccagaaagggaagaaatttaccccggaaagcgtttctcgcctgttggaaaaaatcagtgctggtggttacggtgacaagcgtctctcgccaaaagagagtgaagttctgcgcctgtttgcggaaggcttcctggtgaccgagatcgctaaaaagctgaaccgcagtattaaaaccatcagtagccagaagaaatctgcgatgatgaagctgggtgtcgagaacgatatcgccctgctgaattatctctcttcagtgaccttaagtccggcagataaagactaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z