BBa_K2003012 1 BBa_K2003012 Inducible Green Fluorescent Protein UnaG+Flexible Linker 2016-09-28T11:00:00Z 2016-09-29T11:23:04Z Synthesized by PCR mutagenesis from UnaG sequence designed and ordered from IDT. The inducible green fluorescent protein UnaG is 15.6 kDa, i.e. around half the size of GFP. It has maximum absorption at 498 nm and emits light at 527 nm. UnaG fluoresces only when the heme metabolite bilirubin is added (in its unconjugated form), either to a protein solution or to bacterial cells exogenously. The flexible linker is six amino acids long, added to the C terminus, enabling fusion of UnaG to other proteins. false false _2470_ 33951 33951 9 false The original UnaG sequence was ordered from IDT with a 6xhistidine tag on the 5' end and a flexible linker on the 3' end. However, the first two codons before the flexible linker were stop codons, meaning that the default UnaG does not translate the flexible linker. The histidine tag and the stop codons were removed from the sequence by PCR, resulting in a UnaG sequence without the histidine tag and with the flexible linker. false Tora H??vermark annotation2485400 1 UnaG range2485400 1 1 424 annotation2485399 1 Flexible linker range2485399 1 425 442 BBa_K2003012_sequence 1 atggttgaaaagtttgtcggtacctggaaaattgcggactctcacaattttggagagtatctcaaggctattggagcacccaaggaattgagtgatggtggtgacgcaactacaccgacattatatatttcgcagaaagatggggataagatgactgttaaaatcgagaatgggccgccaactttccttgatacacaggtcaagttcaaacttggagaggagttcgacgagtttccgtcagatcgtcgtaagggcgtaaagtcggtcgttaatcttgtcggtgaaaagttagtgtatgttcagaaatgggacggaaaggaaacgacgtatgtgcgcgagatcaaagacgggaaactggtagttacgttgactatgggtgacgtggtagctgtccgctcctaccgtcgcgctactgagggatcaggtggatcgggttaccggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z