BBa_K2004007 1 CDO Cysteine dioxygenase (CDO) 2016-10-17T11:00:00Z 2016-10-18T11:17:59Z The sequence of this part was taken from the NCBI databank, and the original sequence belongs to Enterobacter aerogenes. Cysteine dioxygenase (CDO, 2 EC 1.13.11.20) is a non-heme mononuclear iron metalloenzyme that catalyzes the irreversible oxidation of cysteine to cysteine sulfinic acid (CSA) with addition of molecular oxygen. This enzyme has a length of 200 aminoacids and a mass of 22,972 Daltons (UniProt, 2005). The product of the reaction catalyzed by CDO, cysteine sulfinic acid, is either decarboxylated to hypotaurine, which is further oxidized to taurine by a poorly understood mechanism. false false _2471_ 25099 25099 9 false This sequence was optimized to be able to use in E. coli in addition to be free of restriction sites into the coding region. This biobrick can be used in RFC 10. false Marco V. Lincango Y. BBa_K2004000 1 BBa_K2004000 Contitutive expression of CDO 2016-10-17T11:00:00Z 2016-10-18T11:55:27Z The part came from NCBI databank, of the Enterobacter aerogenes. This device allows the teams use a entire and functional sequence for the constitutive expression of the enzyme CDO1 (Cysteine dioxigenase) EC 1.13.11.20, which catalyzes the irreversible oxidation od cysteine to cysteine sulfinic acid, with addition of molecular oxygen. The enzyme has a lenght of 200 aminoacids. false false _2471_ 25099 25099 9 false The sequence was codon optimized for E.coli. false Marco V. Lincango Y. component2517390 1 BBa_B0015 component2517382 1 BBa_J61101 component2517381 1 BBa_J23101 component2517383 1 BBa_K2004007 annotation2517390 1 BBa_B0015 range2517390 1 674 802 annotation2517383 1 BBa_K2004007 range2517383 1 62 665 annotation2517382 1 BBa_J61101 range2517382 1 44 55 annotation2517381 1 BBa_J23101 range2517381 1 1 35 BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J61101_sequence 1 aaagacaggacc BBa_K2004000_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagacaggacctactagatgaccgcgccgcgcgtggaaaaactgcgccagtttattcaggatctggatgcgctgcatcgccagtttaccgatgaagcgaccctgctggatgcggtggcggtgcgcctggcgagcctggtgcagaaagatgattggctgccggaagaatataccctgccgcatccgcatcattatcagcagtatctgctgcatgcggatagcggccagcgctttagcattgtgagctttgtgtggggcccgggccagagcaccccgattcatgatcatcgcgtgtggggcgcgattggcatgctgcgcggcgcggaagaaaaccagcgctatcgcctggatgaacgcggcctgccgattgcgaccggcccggcggaacgcctgagcccgggcaaagtggaaaaagtgagcagccgcgatggcgatattcatcgcgtgagcaacgcgctggcggatcatgtgagcattagcattcatgtgtatggcgcgaacattggcggcgtgcgccgcgcggtgtataccgcggatggcattgcgaaaccgtttgtgagcggctatagcaaccgccatctgccgaacatttgggatctgagcaaagataacgaatatgcgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K2004007_sequence 1 atgaccgcgccgcgcgtggaaaaactgcgccagtttattcaggatctggatgcgctgcatcgccagtttaccgatgaagcgaccctgctggatgcggtggcggtgcgcctggcgagcctggtgcagaaagatgattggctgccggaagaatataccctgccgcatccgcatcattatcagcagtatctgctgcatgcggatagcggccagcgctttagcattgtgagctttgtgtggggcccgggccagagcaccccgattcatgatcatcgcgtgtggggcgcgattggcatgctgcgcggcgcggaagaaaaccagcgctatcgcctggatgaacgcggcctgccgattgcgaccggcccggcggaacgcctgagcccgggcaaagtggaaaaagtgagcagccgcgatggcgatattcatcgcgtgagcaacgcgctggcggatcatgtgagcattagcattcatgtgtatggcgcgaacattggcggcgtgcgccgcgcggtgtataccgcggatggcattgcgaaaccgtttgtgagcggctatagcaaccgccatctgccgaacatttgggatctgagcaaagataacgaatatgcga BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z