BBa_K2004007 1 CDO Cysteine dioxygenase (CDO) 2016-10-17T11:00:00Z 2016-10-18T11:17:59Z The sequence of this part was taken from the NCBI databank, and the original sequence belongs to Enterobacter aerogenes. Cysteine dioxygenase (CDO, 2 EC 1.13.11.20) is a non-heme mononuclear iron metalloenzyme that catalyzes the irreversible oxidation of cysteine to cysteine sulfinic acid (CSA) with addition of molecular oxygen. This enzyme has a length of 200 aminoacids and a mass of 22,972 Daltons (UniProt, 2005). The product of the reaction catalyzed by CDO, cysteine sulfinic acid, is either decarboxylated to hypotaurine, which is further oxidized to taurine by a poorly understood mechanism. false false _2471_ 25099 25099 9 false This sequence was optimized to be able to use in E. coli in addition to be free of restriction sites into the coding region. This biobrick can be used in RFC 10. false Marco V. Lincango Y. BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K2004001 1 BBa_K2004001 Construct of CDO 2016-10-17T11:00:00Z 2016-10-18T12:01:23Z NCBI data bank. Enterobacter microorganism. This device has the same function and viability of BBa_K2004007, and it is located in the registry to ease the assemble with other parts of the registry. false false _2471_ 25099 25099 9 false Codon optimized for E. coli and cleaned up from restriction sites. false Marco V. Lincango Y. component2517391 1 BBa_J23101 component2517393 1 BBa_K2004007 component2517392 1 BBa_J61101 annotation2517392 1 BBa_J61101 range2517392 1 44 55 annotation2517391 1 BBa_J23101 range2517391 1 1 35 annotation2517393 1 BBa_K2004007 range2517393 1 62 665 BBa_J61101_sequence 1 aaagacaggacc BBa_K2004001_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagacaggacctactagatgaccgcgccgcgcgtggaaaaactgcgccagtttattcaggatctggatgcgctgcatcgccagtttaccgatgaagcgaccctgctggatgcggtggcggtgcgcctggcgagcctggtgcagaaagatgattggctgccggaagaatataccctgccgcatccgcatcattatcagcagtatctgctgcatgcggatagcggccagcgctttagcattgtgagctttgtgtggggcccgggccagagcaccccgattcatgatcatcgcgtgtggggcgcgattggcatgctgcgcggcgcggaagaaaaccagcgctatcgcctggatgaacgcggcctgccgattgcgaccggcccggcggaacgcctgagcccgggcaaagtggaaaaagtgagcagccgcgatggcgatattcatcgcgtgagcaacgcgctggcggatcatgtgagcattagcattcatgtgtatggcgcgaacattggcggcgtgcgccgcgcggtgtataccgcggatggcattgcgaaaccgtttgtgagcggctatagcaaccgccatctgccgaacatttgggatctgagcaaagataacgaatatgcga BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K2004007_sequence 1 atgaccgcgccgcgcgtggaaaaactgcgccagtttattcaggatctggatgcgctgcatcgccagtttaccgatgaagcgaccctgctggatgcggtggcggtgcgcctggcgagcctggtgcagaaagatgattggctgccggaagaatataccctgccgcatccgcatcattatcagcagtatctgctgcatgcggatagcggccagcgctttagcattgtgagctttgtgtggggcccgggccagagcaccccgattcatgatcatcgcgtgtggggcgcgattggcatgctgcgcggcgcggaagaaaaccagcgctatcgcctggatgaacgcggcctgccgattgcgaccggcccggcggaacgcctgagcccgggcaaagtggaaaaagtgagcagccgcgatggcgatattcatcgcgtgagcaacgcgctggcggatcatgtgagcattagcattcatgtgtatggcgcgaacattggcggcgtgcgccgcgcggtgtataccgcggatggcattgcgaaaccgtttgtgagcggctatagcaaccgccatctgccgaacatttgggatctgagcaaagataacgaatatgcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z