BBa_K2004007 1 CDO Cysteine dioxygenase (CDO) 2016-10-17T11:00:00Z 2016-10-18T11:17:59Z The sequence of this part was taken from the NCBI databank, and the original sequence belongs to Enterobacter aerogenes. Cysteine dioxygenase (CDO, 2 EC 1.13.11.20) is a non-heme mononuclear iron metalloenzyme that catalyzes the irreversible oxidation of cysteine to cysteine sulfinic acid (CSA) with addition of molecular oxygen. This enzyme has a length of 200 aminoacids and a mass of 22,972 Daltons (UniProt, 2005). The product of the reaction catalyzed by CDO, cysteine sulfinic acid, is either decarboxylated to hypotaurine, which is further oxidized to taurine by a poorly understood mechanism. false false _2471_ 25099 25099 9 false This sequence was optimized to be able to use in E. coli in addition to be free of restriction sites into the coding region. This biobrick can be used in RFC 10. false Marco V. Lincango Y. BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206608 1 Stop range2206608 1 31 33 annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 annotation2206609 1 Stop range2206609 1 34 36 BBa_K2004003 1 BBa_K2004003 CDO HIS 2016-10-17T11:00:00Z 2016-10-18T12:29:00Z NCBI data bank. Enterobacter microorganism. This device is a construct for constitutive expression of CDO enzyme with a poly-his tag attached downstream to ease the protein purification, this device could be used to ease the assemble with other parts of the registry. For more information about this enzyme, look for BBa_K2004007. false false _2471_ 25099 25099 9 Not in stock false Codon optimized for E. coli and cleaned up from restriction sites. false Marco V. Lincango Y. component2517446 1 BBa_J61101 component2517447 1 BBa_K2004007 component2517445 1 BBa_J23101 component2517451 1 BBa_K844000 annotation2517446 1 BBa_J61101 range2517446 1 44 55 annotation2517451 1 BBa_K844000 range2517451 1 674 709 annotation2517445 1 BBa_J23101 range2517445 1 1 35 annotation2517447 1 BBa_K2004007 range2517447 1 62 665 BBa_J61101_sequence 1 aaagacaggacc BBa_K2004003_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagacaggacctactagatgaccgcgccgcgcgtggaaaaactgcgccagtttattcaggatctggatgcgctgcatcgccagtttaccgatgaagcgaccctgctggatgcggtggcggtgcgcctggcgagcctggtgcagaaagatgattggctgccggaagaatataccctgccgcatccgcatcattatcagcagtatctgctgcatgcggatagcggccagcgctttagcattgtgagctttgtgtggggcccgggccagagcaccccgattcatgatcatcgcgtgtggggcgcgattggcatgctgcgcggcgcggaagaaaaccagcgctatcgcctggatgaacgcggcctgccgattgcgaccggcccggcggaacgcctgagcccgggcaaagtggaaaaagtgagcagccgcgatggcgatattcatcgcgtgagcaacgcgctggcggatcatgtgagcattagcattcatgtgtatggcgcgaacattggcggcgtgcgccgcgcggtgtataccgcggatggcattgcgaaaccgtttgtgagcggctatagcaaccgccatctgccgaacatttgggatctgagcaaagataacgaatatgcgatactagagcatcatcaccatcaccaccatcatcaccattaataa BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K2004007_sequence 1 atgaccgcgccgcgcgtggaaaaactgcgccagtttattcaggatctggatgcgctgcatcgccagtttaccgatgaagcgaccctgctggatgcggtggcggtgcgcctggcgagcctggtgcagaaagatgattggctgccggaagaatataccctgccgcatccgcatcattatcagcagtatctgctgcatgcggatagcggccagcgctttagcattgtgagctttgtgtggggcccgggccagagcaccccgattcatgatcatcgcgtgtggggcgcgattggcatgctgcgcggcgcggaagaaaaccagcgctatcgcctggatgaacgcggcctgccgattgcgaccggcccggcggaacgcctgagcccgggcaaagtggaaaaagtgagcagccgcgatggcgatattcatcgcgtgagcaacgcgctggcggatcatgtgagcattagcattcatgtgtatggcgcgaacattggcggcgtgcgccgcgcggtgtataccgcggatggcattgcgaaaccgtttgtgagcggctatagcaaccgccatctgccgaacatttgggatctgagcaaagataacgaatatgcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z