BBa_K2004004 1 BBa_K2004004 spisPink: Pink chromoprotein optimized for E.coli 2016-10-17T11:00:00Z 2016-10-18T10:43:40Z This part is an improved version of BBa_K1684000, designed by BIOSINT_Mexico previous team. Chromoproteins are a collection of proteins that express pigments. This protein, expressed in Stylophora pistillata, was evolving independently from the rest of coral chromoproteins. The protein has a maximum absorption of 560 nm. This characteristic confers a blue shift by at least 14 nanometers in comparison to other known coral chromoproteins, inducing the production of pink color. This basic part can be used for whatever E. coli strain and is able to use with RFC 10 assembly. false false _2471_ 25099 25099 9 false The sequence was analyzed by softwars and we noticed some mistakes into the sequence to be part of the standardized biobrick library. This new version of the part contains all the specifications required to be a functional biobrick. false Marco V. Lincango Y. BBa_K2004004_sequence 1 atgtcccacagcaagcaggcattagccgacaccatgaaaatgacatggctgatggaaggtagcgtcaatgggcatgcatttacgattgaaggtgagggcacggggaaaccatatgagggcaaacagagcgggacgttccgcgtgaccaaaggtgggccgctgccctttgctttcgacatcgtagctccaacgttaaaatatggttttaagtgctttatgaaatatcccgcagacattccggattatttcaaactggcgtttccggagggtttaacctacgatcgtaaaattgcgtttgaagatggcggctgtgcaacggcgaccgtggaaatgagtctgaagggtaatactctggtccacaaaaccaacttccaagggggcaactttcctatcgatggcccggtcatgcaaaaacgcacccttgggtgggagccgacgagtgaaaaaatgacgccctgcgacgggatcattaaaggcgataccattatgtacttaatggtagagggtggcaaaaccctcaaatgtcgctacgagaacaattatcgcgcaaacaagcccgttctcatgccgccgtcgcattttgttgacttgcgtctgacccgcactaacctggacaaagagggcttggctttcaagctggaagagtatgcggtggcgcgcgttctggaggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z