BBa_K2005001 1 BBa_K2005001 LacZ-alpha, UV-resistant 2016-10-17T11:00:00Z 2016-10-18T08:22:18Z Synthetic variant of Bba_I732006 LacZ alpha fragment with its coding DNA redesigned to minimize its susceptibility to UV-induced DNA mutation. Compared with standard LacZ, this gene is therefore more stable and less likely to evolve out of a population of cells. To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on radiological damage, which identified dipyrimidine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 39% of poly-guanine motifs and an overall reduction in oxidizable guanines. false false _2472_ 19415 19415 9 false To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on radiological damage, which identified dipyrimidine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 39% of poly-guanine motifs and an overall reduction in oxidizable guanines. false Jarrod Shilts BBa_K2005001_sequence 1 atgaccatgattaccgatagcctggcggtggtgctgcaacgccgtgactgggagaacccgggcgtgacgcagctgaaccgcctggcggcgcacccgccgtttgccagctggcgtaacagcgaggaggcgcgtaccgaccgccccagccagcagctgcgtagcctgaacggcgagtggcgctttgcgtggttcccggcgccggaggcggtgccggagagctggctggagtaata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z