BBa_K2005004 1 BBa_K2005004 LacZ-alpha, oxidation-maximized 2016-10-17T11:00:00Z 2016-10-18T08:36:01Z Synthetic variant of Bba_I732006 LacZ alpha fragment with its coding DNA redesigned to maximize its susceptibility to oxidative DNA damage. Compared with standard LacZ, this gene is therefore more likely to mutate into diverse forms. ===Sequence Design=== To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to introduce mutagenic sites. These sites were identified based on prior research on DNA irradiation, where dipyrimidine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to make replacements for ones with higher mutation risks. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels.Overall we could increase the predicted number of poly-guanine sites by 27% and had an increase in overall guanines. ===Assembly=== This sequence was synthesized and ligated into pSB1C3. We confirmed that this construct was synthesized and integrated correctly by sequencing. false false _2472_ 19415 19415 9 false To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to introduce mutagenic sites. These sites were identified based on prior research on DNA irradiation, where dipyrimidine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to make replacements for ones with higher mutation risks. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels.Overall we could increase the predicted number of poly-guanine sites by 27% and had an increase in overall guanines. false Jarrod Shilts BBa_K2005004_sequence 1 atgaccatgatcaccgactccctggccgtggtcctccagcgccgcgactgggagaaccccggggtcacccagctcaaccgcctggccgcccaccccccattcgcctcctggcgcaactccgaggaggcccgcaccgaccgcccctcccagcagctccgctccctcaacggggagtggcgcttcgcctggttccccgccccagaggccgtccccgagtcctggctggagtgatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z