BBa_K2005012 1 BBa_K2005012 Dipyrimidine-50 2016-10-11T11:00:00Z 2016-10-11T11:18:38Z Synthetic DNA Synthetic DNA construct designed to have a set number of dipyrimidine (TT,CT,TC,CC) sites at 50 sites per 175 bp. Because repeated pyrimidine tracts are the major determinant of where DNA lesions form upon ultraviolet (UV) irradiation (Ikehata and Ono 2011), this sequence is a tool for studying the mechanisms of mutagenesis under controlled conditions. ===Sequence Design=== To generate this artificial DNA sequence, we wrote an algorithm that modified a seed sequence until it met parameters for the number of dipyrimidine sites and other constraints to make it compatible with current DNA synthesis restrictions . In addition, the sequence was designed to include sites for annealing by ActB qPCR primers to facilitate sequence-specific amplification and further analyses. ===Assembly=== This sequence was synthesized and ligated into pSB1C3. We confirmed that this construct was synthesized and integrated correctly by sequencing. ===Mutagenicity=== We analyzed the rates of UV-induced mutagenic DNA lesions using quantitative PCR (qPCR) and immunoblotting. Using parts K2005010, K2005011, and K2005012 which contain 25, 35, and 50 dipyrimidine sites respectively, we found that relative mutation frequency could be predicted based on these controlled changes to the primary nucleotide sequence. Please see our 2016 wiki for more details. ==References== Ikehata, H., and Ono, T. (2011). The mechanisms of UV mutagenesis. J. Radiat. Res. 52, 115???125. false false _2472_ 19415 19415 9 false To generate this artificial DNA sequence, we wrote an algorithm that modified a seed sequence until it met parameters for the number of dipyrimidine sites and other constraints to make it compatible with current DNA synthesis restrictions . In addition, the sequence was designed to include sites for annealing by ActB qPCR primers to facilitate sequence-specific amplification and further analyses. false Jarrod Shilts BBa_K2005012_sequence 1 actctggctcctagcaccatgaagaacgtcatatgtgtacgatacgtaacgatgtgacgcatcattgcaatcgtagcatcgcatcgacggtatgtaatacgattgtttatgtactaacgcatcgtattgcgttacacgcaacgtgtgtatgcggactgttactgagctgcgttttac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z