BBa_K2005020 1 BBa_K2005020 Poly(1)Guanine-90 2016-10-11T11:00:00Z 2016-10-12T01:19:25Z Synthetic DNA Synthetic DNA construct designed to have a set number of poly(1)-guanine motifs within a 175 bp region. These motifs have been implicated in DNA oxidation as elements which at longer repeat lengths can increase the rate of local oxidative mutation (Senthikumar et al. 2003). For making controlled comparisons between synthesized sequences, the total number of guanines are held at a constant value with only their motif-arrangement being manipulated. ===Sequence Design=== To generate this artificial DNA sequence, we wrote an algorithm that generated a sequence with the desired number of motifs organized into evenly-spread regions. This initial sequence was then altered according to rules that preserved the motif structure until it met a set of constraints to make it compatible with current DNA synthesis restrictions . In addition, the sequence was designed to include sites for annealing by ActB qPCR primers to facilitate sequence-specific amplification and further analyses. ===Assembly=== This sequence was synthesized and ligated into pSB1C3. We confirmed that this construct was synthesized and integrated correctly by sequencing. ===Mutagenicity=== We analyzed the rates of oxidation-induced mutagenic DNA lesions using liquid-chromatography mass-spectrometry (LC-MS) and immunoblotting. Using parts K2005020, K2005021, and K2005022 which contain poly-G regions of length 1, 2, and 3 respectively, we found that relative mutation frequency could be predicted based on these controlled changes to the primary nucleotide sequence. Please see our 2016 wiki for more details. ==References== Senthilkumar, K., Grozema, F.C., Guerra, C.F., Bickelhaupt, F.M., and Siebbeles, L.D.A. (2003). Mapping the sites for selective oxidation of guanines in DNA. J. Am. Chem. Soc. 125, 13658???13659. false false _2472_ 19415 19415 9 false To generate this artificial DNA sequence, we wrote an algorithm that generated a sequence with the desired number of motifs organized into evenly-spread regions. This initial sequence was then altered according to rules that preserved the motif structure until it met a set of constraints to make it compatible with current DNA synthesis restrictions . In addition, the sequence was designed to include sites for annealing by ActB qPCR primers to facilitate sequence-specific amplification and further analyses. false Jarrod Shilts BBa_K2005020_sequence 1 ctctcacacacactactacatgaactctctgtgtacactcatctgaactgtctgatgtctgtcactgtgtcagagtctcagagtgtgacatcagtgatgagactcagagtactacagtgtcacatgtagatctctacactcagactgtgacacactctacttcacagtgagacacatctctcacttcagtgtcagtagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z