BBa_K2005050 1 BBa_K2005050 mCherry (oxidation-resistant) 2016-10-17T11:00:00Z 2016-10-18T08:41:32Z Synthetic variant of Bba_J06504 mCherry red fluorescent protein (RFP) with its coding DNA sequence redesigned to minimize its susceptibility to oxidative DNA mutation. Compared with standard mCherry, this gene is therefore more stable and less likely to evolve out of a population of cells. ===Sequence Design=== To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on DNA oxidation, which identified poly-guanine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines. ===Assembly=== This sequence was synthesized and ligated into pSB1C3. We confirmed that this construct was synthesized and integrated correctly by sequencing. We cloned this gene with a T7 promoter (K2005061) to verify that both the function and expression of the fluorescent protein. ===Mutagenicity=== We quantified levels of oxidized guanine using mass spectrometry on purified samples of optimized mCherry. Comparison to the control mCherry Bba_J06504 verified that our optimization of this sequence reduced the rate of mutation. Please see our 2016 wiki for more details. ==References== Senthilkumar, K., Grozema, F.C., Guerra, C.F., Bickelhaupt, F.M., and Siebbeles, L.D.A. (2003). Mapping the sites for selective oxidation of guanines in DNA. J. Am. Chem. Soc. 125, 13658???13659. false false _2472_ 19415 19415 9 false To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on DNA oxidation, which identified poly-guanine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines. false Jarrod Shilts BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2129433 1 RBS range2129433 1 24 27 annotation2129432 1 T7 promoter range2129432 1 1 20 annotation2127788 1 B0034 range2127788 1 21 32 BBa_K2005051 1 BBa_K2005051 mCherry with T7 expression (oxidation-resistant) 2016-10-17T11:00:00Z 2016-10-18T08:44:10Z K525998 and K2005050 GFP sequence that is engineered to be resistant against UV mutations that has strong inducible expression under the T7 promoter. The GFP is based on part K2005050 and the promoter is K525998. false false _2472_ 19415 19415 9 false See the page for K2005050 false Jarrod Shilts component2520123 1 BBa_K525998 component2520124 1 BBa_K2005050 annotation2520123 1 BBa_K525998 range2520123 1 1 32 annotation2520124 1 BBa_K2005050 range2520124 1 39 752 BBa_K2005051_sequence 1 taatacgactcactatagggaaagaggagaaatactagatggtttctaaaggtgaagaagataacatggcaattattaaagaatttatgcgttttaaagttcatatggaaggttctgttaatggtcatgaatttgaaattgaaggtgaaggtgaaggtcgtccatatgaaggtactcaaactgcaaaattaaaagttactaaaggtggtccattaccatttgcatgggatattttatctccacaatttatgtatggttctaaagcatatgttaaacatccagcagatattccagattatctgaaactgagctttccagaaggttttaaatgggaacgtgttatgaattttgaagatggtggtgttgttactgttactcaagattcttctctacaagatggtgaatttatttataaagtgaaactacgtggtactaattttccatctgatggtccagttatgcagaaaaaaactatgggttgggaagcgagcagcgaacgtatgtatccagaagatggtgcattaaaaggtgaaattaaacaacgtttgaaactgaaagatggtggtcattatgatgcagaagtgaaaactacttataaagcgaaaaaaccagttcagttaccaggtgcatataatgtgaacattaaattagatattacttctcataacgaagattatactattgttgaacaatatgaacgtgcagaaggtcgtcattctactggtggtatggatgaactgtataaataataa BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_K2005050_sequence 1 atggtttctaaaggtgaagaagataacatggcaattattaaagaatttatgcgttttaaagttcatatggaaggttctgttaatggtcatgaatttgaaattgaaggtgaaggtgaaggtcgtccatatgaaggtactcaaactgcaaaattaaaagttactaaaggtggtccattaccatttgcatgggatattttatctccacaatttatgtatggttctaaagcatatgttaaacatccagcagatattccagattatctgaaactgagctttccagaaggttttaaatgggaacgtgttatgaattttgaagatggtggtgttgttactgttactcaagattcttctctacaagatggtgaatttatttataaagtgaaactacgtggtactaattttccatctgatggtccagttatgcagaaaaaaactatgggttgggaagcgagcagcgaacgtatgtatccagaagatggtgcattaaaaggtgaaattaaacaacgtttgaaactgaaagatggtggtcattatgatgcagaagtgaaaactacttataaagcgaaaaaaccagttcagttaccaggtgcatataatgtgaacattaaattagatattacttctcataacgaagattatactattgttgaacaatatgaacgtgcagaaggtcgtcattctactggtggtatggatgaactgtataaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z