BBa_K2005060
1
BBa_K2005060
GFP (UV-resistant)
2016-10-13T11:00:00Z
2016-10-18T08:40:35Z
Synthetic variant of Bba_J06504
__NOTOC__
<partinfo>BBa_K2005060 short</partinfo>
mCherry red fluorescent protein (RFP) with its coding DNA sequence redesigned to minimize its susceptibility to oxidative DNA mutation. Compared with standard mCherry, this gene is therefore more stable and less likely to evolve out of a population of cells.
===Sequence Design===
To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on DNA oxidation, which identified poly-guanine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines.
===Assembly===
This sequence was synthesized and ligated into pSB1C3. We confirmed that this construct was synthesized and integrated correctly by sequencing. We cloned this gene with a T7 promoter (K2005061) to verify that both the function and expression of the fluorescent protein.
===Mutagenicity===
We quantified levels of oxidized guanine using mass spectrometry on purified samples of optimized mCherry. Comparison to the control mCherry Bba_J06504 verified that our optimization of this sequence reduced the rate of mutation. Please see our 2016 wiki for more details.
==References==
Senthilkumar, K., Grozema, F.C., Guerra, C.F., Bickelhaupt, F.M., and Siebbeles, L.D.A. (2003). Mapping the sites for selective oxidation of guanines in DNA. J. Am. Chem. Soc. 125, 13658???13659.
false
false
_2472_
19415
19415
9
false
To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on DNA oxidation, which identified poly-guanine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines.
false
Jarrod Shilts
BBa_K2005060_sequence
1
atgcgtaagggcgaggagctgtttaccggcgtggtgcccatcctggtggagctggatggcgatgtgaacggccataagtttagcgtgagcggcgagggcgagggcgatgccacgtatggcaagctgacgctgaagtttatctgcaccaccggcaagctgccggtgccgtggcccacgctggtgaccacgtttgggtatggcgtgcagtgctttgcgcgctacccggaccatatgaagcagcatgacttctttaagagcgccatgccggaggggtatgtgcaggagcgtaccatcttctttaaggatgatggcaactataagacgcgtgcggaggtgaagtttgagggcgatacgctggtgaaccgtattgagctgaagggcattgactttaaggaggatggcaacatcctgggccataagctggagtataactataacagccataacgtgtatattatggcggataagcagaagaacggcattaaggtgaactttaagatccgccataacattgaggatggcagcgtgcagctggcggaccactaccagcagaacacgcccattggcgatggcccggtgctgctgccggataaccactacctgagcacgcagagcgcgctgagcaaggaccccaacgagaagcgtgaccatatggtgctgctggagtttgtgaccgcggcgggcattacgcatggcatggatgagctgtataagtaataa
igem2sbol
1
iGEM to SBOL conversion
Conversion of the iGEM parts registry to SBOL2.1
Chris J. Myers
James Alastair McLaughlin
2017-03-06T15:00:00.000Z