BBa_K2005060 1 BBa_K2005060 GFP (UV-resistant) 2016-10-13T11:00:00Z 2016-10-18T08:40:35Z Synthetic variant of Bba_J06504 __NOTOC__ <partinfo>BBa_K2005060 short</partinfo> mCherry red fluorescent protein (RFP) with its coding DNA sequence redesigned to minimize its susceptibility to oxidative DNA mutation. Compared with standard mCherry, this gene is therefore more stable and less likely to evolve out of a population of cells. ===Sequence Design=== To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on DNA oxidation, which identified poly-guanine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines. ===Assembly=== This sequence was synthesized and ligated into pSB1C3. We confirmed that this construct was synthesized and integrated correctly by sequencing. We cloned this gene with a T7 promoter (K2005061) to verify that both the function and expression of the fluorescent protein. ===Mutagenicity=== We quantified levels of oxidized guanine using mass spectrometry on purified samples of optimized mCherry. Comparison to the control mCherry Bba_J06504 verified that our optimization of this sequence reduced the rate of mutation. Please see our 2016 wiki for more details. ==References== Senthilkumar, K., Grozema, F.C., Guerra, C.F., Bickelhaupt, F.M., and Siebbeles, L.D.A. (2003). Mapping the sites for selective oxidation of guanines in DNA. J. Am. Chem. Soc. 125, 13658???13659. false false _2472_ 19415 19415 9 false To generate this artificial DNA sequence, we employed our custom-made algorithm for modifying gene sequences to eliminate mutagenic sites. These sites were identified based on prior research on DNA oxidation, which identified poly-guanine motifs as particularly vulnerable. At these motifs, synonymous codon substitutions were made to eliminate oxidation-prone nucleotide sequences and replace them with ones with a lower mutation risk. In addition, our algorithm used heuristics to factor in the effect different codons have on gene expression to ensure that the gene not only produced the same protein but produced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines. false Jarrod Shilts BBa_K2005060_sequence 1 atgcgtaagggcgaggagctgtttaccggcgtggtgcccatcctggtggagctggatggcgatgtgaacggccataagtttagcgtgagcggcgagggcgagggcgatgccacgtatggcaagctgacgctgaagtttatctgcaccaccggcaagctgccggtgccgtggcccacgctggtgaccacgtttgggtatggcgtgcagtgctttgcgcgctacccggaccatatgaagcagcatgacttctttaagagcgccatgccggaggggtatgtgcaggagcgtaccatcttctttaaggatgatggcaactataagacgcgtgcggaggtgaagtttgagggcgatacgctggtgaaccgtattgagctgaagggcattgactttaaggaggatggcaacatcctgggccataagctggagtataactataacagccataacgtgtatattatggcggataagcagaagaacggcattaaggtgaactttaagatccgccataacattgaggatggcagcgtgcagctggcggaccactaccagcagaacacgcccattggcgatggcccggtgctgctgccggataaccactacctgagcacgcagagcgcgctgagcaaggaccccaacgagaagcgtgaccatatggtgctgctggagtttgtgaccgcggcgggcattacgcatggcatggatgagctgtataagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z