BBa_K2008000 1 BBa_K2008000 Bowman Birk Protease Inhibitor (BBI) active nonamer 2016-10-07T11:00:00Z 2016-10-08T03:14:00Z Members of the lentil family produce the full BBI protein, and the genetic sequence for the peptide was sourced originally from genomic DNA. This part contains an active nonamer from the Bowman Birk Protease Inhibitor (BBI) with the addition of lysine, serine, cysteine, and isoleucine (KSCI) tag on the N-terminal end and a phenylalanine (F) tag on the C-terminal end to increase BBI solubility. This component of the composite part is fused to the N-terminal end of GFP part BBA_E0040 for visual detection, and the entire part is under the control of the constitutive E. coli promoter BBa_J23100 and the RBS BBa_B0034. true false _2475_ 30207 30207 9 false We used a strong RBS and constitutive promoter to produce high levels of expression of the BBI-KSCI tagged protein fused to GFP for visualization. false Rachelle Varga, Nishi Patel annotation2488261 1 conserved range2488261 1 48 51 annotation2488262 1 BBa_B0034 range2488262 1 44 55 annotation2488263 1 GFP protein range2488263 1 62 781 annotation2488260 1 BBa_J23100 range2488260 1 1 35 annotation2488264 1 BBa_E0040 range2488264 1 62 781 BBa_K2008000_sequence 1 aaatcatgcatttgcgcactgtcatatccggcacaatgcttttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z