BBa_K2008001 1 BBa_K2008001 BBI with N-terminal KSCI solubility tag fused to GFP 2016-10-07T11:00:00Z 2016-10-18T01:13:49Z Members of the lentil family produce the full BBI protein, and the genetic sequence for the peptide was sourced originally from genomic DNA. This part contains an active nonamer from the Bowman Birk Protease Inhibitor (BBI) with the addition of lysine, serine, cysteine, and isoleucine (KSCI) tag on the N-terminal end and a phenylalanine (F) tag on the C-terminal end to increase BBI solubility. This component of the composite part is fused to the N-terminal end of GFP part BBA_E0040 for visual detection, and the entire part is under the control of the constitutive E. coli promoter BBa_J23100 and the RBS BBa_B0034. Note: This part is a composite part, not a basic part. false false _2475_ 30207 30207 9 false We used a strong RBS and constitutive promoter to produce high levels of expression of the BBI-KSCI tagged protein fused to GFP for visualization. false Rachelle Varga annotation2488309 1 BBa_B0034 range2488309 1 36 47 annotation2488308 1 BBa_J23100 range2488308 1 1 35 annotation2488311 1 BBa_E0040 range2488311 1 102 812 annotation2488498 1 Start codon range2488498 1 57 59 annotation2488310 1 BBI with KSCI solubility tag range2488310 1 60 101 annotation2488499 1 Double stop codon range2488499 1 813 818 BBa_K2008001_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcaaagaggagaaaatatatataatgaaaagctgcatttgcgcgctgagctatccggcgcagtgctttcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z