BBa_K2008003 1 BBa_K2008003 pVeg->sec-TD1-KSCI-BBI-GFP 2016-10-07T11:00:00Z 2016-10-08T08:20:16Z Members of the lentil family produce the full BBI protein, and the genetic sequence for the peptide was sourced originally from genomic DNA. This part contains an active nonamer from the Bowman Birk Protease Inhibitor (BBI). A B. subtilis secretory signal peptide sequence is included to allow for secretion of the peptide directly into surrounding media. A transdermal tag (TD1, BBa_K1074000) is fused to the N-terminus of BBI to allow for diffusion of the peptide across the skin. Restriction enzyme sites BamHI and XmaI flank the BBI sequence for the interchangeability of protein product. This construct is fused to GFP (BBa_E0040) for visual detection, and the entire coding sequence is under the control of the constitutive B. subtilis promoter pVeg (BBa_K143012) and a strong B. subtilis RBS (BBa_K780001). Note: This part is a composite part, not a basic part, but it could not be entered as composite at this time. false false _2475_ 30207 30207 9 false Bacillus subtilis-specific components were used (strong RBS and constitutive promoter) to produce high levels of expression of the BBI peptide fused to GFP for visualization. A secretory signal peptide sequence was included to allow for secretion of the peptide directly into surrounding media. A transdermal tag allowed for diffusion of the peptide across the skin. Internal restriction enzymes sites were added for peptide product interchangeability. Codons were optimized for B. subtilis. false Rachelle Varga annotation2488501 1 BBa_K780001 range2488501 1 98 113 annotation2488504 1 BBa_K1074000 range2488504 1 210 242 annotation2488505 1 BBI with KSCI solubility tag range2488505 1 243 248 annotation2488507 1 Double stop codon range2488507 1 996 1001 annotation2488502 1 Start codon range2488502 1 123 125 annotation2488503 1 Sec tag range2488503 1 126 209 annotation2488506 1 BBa_E0040 range2488506 1 285 995 annotation2488500 1 BBa_K143012 range2488500 1 1 97 BBa_K2008003_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtatattaagaggaggagatatatataatgaatatcaagaagttcgcaaaacaggcgacagtcctgacctttaccaccgccctcttggcagggggggcgacccaggcattcgctgcttgttcttcttccccatctaagcattgtggtaaatcatgcatttgcgcactgtcatatccggcacaatgctttcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z