BBa_K2008004 1 BBa_K2008004 pVeg->sec-TD1-BBI 2016-10-07T11:00:00Z 2016-10-08T08:25:46Z Members of the lentil family produce the full BBI protein, and the genetic sequence for the peptide was sourced originally from genomic DNA. This part contains an active nonamer from the Bowman Birk Protease Inhibitor (BBI). A B. subtilis secretory signal peptide sequence is included to allow for secretion of the peptide directly into surrounding media. A transdermal tag (TD1, BBa_K1074000) is fused to the N-terminus of BBI to allow for diffusion of the peptide across the skin. This coding sequence is under the control of the constitutive B. subtilis promoter pVeg (BBa_K143012) and a strong B. subtilis RBS (BBa_K780001). Note: This part is a composite part, not a basic part, but it could not be entered as composite at this time. false false _2475_ 30207 30207 9 false Bacillus subtilis-specific components were used (strong RBS and constitutive promoter) to produce high levels of expression of the BBI peptide. A secretory signal peptide sequence was included to allow for secretion of the peptide directly into surrounding media. A transdermal tag allowed for diffusion of the peptide across the skin. Codons were optimized for B. subtilis. false Rachelle Varga annotation2488511 1 Sec tag range2488511 1 126 209 annotation2488509 1 BBa_K780001 range2488509 1 98 113 annotation2488512 1 BBa_K1074000 range2488512 1 210 242 annotation2488508 1 BBa_K143012 range2488508 1 1 97 annotation2488510 1 Start codon range2488510 1 123 125 annotation2488514 1 Double stop codon range2488514 1 270 275 annotation2488513 1 BBI range2488513 1 243 269 BBa_K2008004_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtatattaagaggaggagatatatataatgaatatcaagaagttcgcaaaacaggcgacagtcctgacctttaccaccgccctcttggcagggggggcgacccaggcattcgctgcttgttcttcttccccatctaagcattgtggttgcgcactgtcatatccggcacaatgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z