BBa_K2008005 1 BBa_K2008005 pVeg->sec-TD1-KSCI-BBI 2016-10-07T11:00:00Z 2016-10-18T02:32:29Z Members of the lentil family produce the full BBI protein, and the genetic sequence for the peptide was sourced originally from genomic DNA. This part contains an active nonamer from the Bowman Birk Protease Inhibitor (BBI) with the addition of lysine, serine, cysteine, and isoleucine (KSCI) tag on the N-terminal end and a phenylalanine (F) tag on the C-terminal end to increase BBI solubility. A B. subtilis secretory signal peptide sequence is included to allow for secretion of the peptide directly into surrounding media. A transdermal tag (TD1, BBa_K1074000) is fused to the N-terminus of BBI to allow for diffusion of the peptide across the skin. This coding sequence is under the control of the constitutive B. subtilis promoter pVeg (BBa_K143012) and a strong B. subtilis RBS (BBa_K780001). Note: This part is a composite part, not a basic part, but it could not be entered as composite at this time. false false _2475_ 30207 30207 9 true Bacillus subtilis-specific components were used (strong RBS and constitutive promoter) to produce high levels of expression of the BBI peptide. A secretory signal peptide sequence was included to allow for secretion of the peptide directly into surrounding media. A transdermal tag allowed for diffusion of the peptide across the skin. Codons were optimized for B. subtilis. Additional amino acids were included to increase solubility of the desired peptide product. false Rachelle Varga annotation2488559 1 BBa_K1074000 range2488559 1 210 242 annotation2488556 1 BBa_K780001 range2488556 1 98 113 annotation2488558 1 Sec tag range2488558 1 126 209 annotation2488561 1 Double stop codon range2488561 1 285 290 annotation2488560 1 BBI with KSCI solubility tag range2488560 1 243 284 annotation2488557 1 Start codon range2488557 1 123 125 annotation2488555 1 BBa_K143012 range2488555 1 1 97 BBa_K2008005_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtatattaagaggaggagatatatataatgaatatcaagaagttcgcaaaacaggcgacagtcctgacctttaccaccgccctcttggcagggggggcgacccaggcattcgctgcttgttcttcttccccatctaagcattgtggtaaatcatgcatttgcgcactgtcatatccggcacaatgcttttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z