BBa_K2009357 1 BBa_K2009357 SUP35 2016-09-13T11:00:00Z 2016-09-17T07:34:59Z PCR from the plasmid provided from Dong Men , PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences Sup35??????PSB1C3 length: 759bp Derived from: PCR from the plasmid provided from Dong Men introduction Sup35p is a subunit of the translation termination complex. In nature, it has been proved to have kinds of prionic effect on the stress response, When the conformation is transformed into prionic form, the termination of translation is less effective and thus new longer proteins form (True and Lindquist, 2000; Tyedmers et al., 2008). Research found that if the sequence corresponding to the NM domains of Sup35p is fused to other gene, the protein resulting of this construction acquires the prionic behaviour (Li and Lindquist, 2000). Tyedmers et al. (2000) found that heat shock is a significantly relevant factor to trigger the prionic conformation. Heat shock will induce The cells the prionic phenotype, it is an autocatalytic process and finally, all the protein is found in the prionic conformation. The cells resulting show the phenotype [PSI+]. One of the most possible reason for phenomenon is that HSP104 play an important role in the formation and maintenance of the amyloid fiber (Halfmann et al., 2009). The SUP35NM gene we used is provided by Dong Men, PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences, so that the sequence is not quite the same as the existing sequence in the Parts Registry, for a lot of mutations have been done. The standardization of this gene is did by ourselves by adding the Biobrick prefix and suffix to its ends and doing a site mutation to eliminate the PstI cutting site inside it. sequence atgtcggattcaaaccagggcaacaaccagcaaaattaccagcagtattcccaaaacggcaaccagcaacaaggtaacaatcgctatcaggggtaccaggcgtacaatgcccaagcacaaccggcaggcggctattatcagaactaccagggctacagcggttaccaacagggtggttatcagcagtataaccccgatgctgggtatcagcagcagtataatccccaaggcgggtatcagcagtacaacccacagggtggctatcagcaacagtttaatccgcagggcggacgcggtaactacaaaaacttcaactataacaataatttacaggggtaccaagctggttttcagcctcagagtcaggggatgtctctgaatgatttccaaaaacagcaaaagcaagcagctccaaaaccgaaaaaaaccctgaaattagtgtccagctcgggaattaaactcgctaacgccacgaagaaggtgggcacgaaaccggctgaaagcgataaaaaagaggaagagaagagcgcggaaaccaaggaaccgaccaaagagccgactaaagtcgaagaacctgtgaaaaaagaagagaaacctgtacagacggaagagaaaactgaggagaaatcggaattacccaaagtcgaggatttgaaaatttcggaaagcacccataacacaaacaatgcgaatgttacatccgcggatgcgttgattaaagaacaggaagaggaagttgacgatgaggtggtgaatgat (All the sequence has been testified by Sangon) false false _2476_ 32614 32614 9 false The SUP35NM gene we used is provided by Dong Men, PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences, so that the sequence is not quite the same as the existing sequence in the Parts Registry, for a lot of mutations have been done. The standardization of this gene is did by ourselves by adding the Biobrick prefix and suffix to its ends and doing a site mutation to eliminate the PstI cutting site inside it. false Kaiyue Ma BBa_K2009357_sequence 1 atgtcggattcaaaccagggcaacaaccagcaaaattaccagcagtattcccaaaacggcaaccagcaacaaggtaacaatcgctatcaggggtaccaggcgtacaatgcccaagcacaaccggcaggcggctattatcagaactaccagggctacagcggttaccaacagggtggttatcagcagtataaccccgatgctgggtatcagcagcagtataatccccaaggcgggtatcagcagtacaacccacagggtggctatcagcaacagtttaatccgcagggcggacgcggtaactacaaaaacttcaactataacaataatttacaggggtaccaagctggttttcagcctcagagtcaggggatgtctctgaatgatttccaaaaacagcaaaagcaagcagctccaaaaccgaaaaaaaccctgaaattagtgtccagctcgggaattaaactcgctaacgccacgaagaaggtgggcacgaaaccggctgaaagcgataaaaaagaggaagagaagagcgcggaaaccaaggaaccgaccaaagagccgactaaagtcgaagaacctgtgaaaaaagaagagaaacctgtacagacggaagagaaaactgaggagaaatcggaattacccaaagtcgaggatttgaaaatttcggaaagcacccataacacaaacaatgcgaatgttacatccgcggatgcgttgattaaagaacaggaagaggaagttgacgatgaggtggtgaatgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z