BBa_K2011000 1 BBa_K2011000 sgrS binding site 2016-10-13T11:00:00Z 2016-10-14T08:00:08Z It's come from BL21(DE3) genomic DNA. sgrS (sugar transport-related sRNA, previously named ryaA) is a small RNA that is activated by SgrR in Escherichia coli during glucose-phosphate stress. The nature of glucose-phosphate stress is not fully understood, but is correlated with intracellular accumulation of glucose-6-phosphate. SgrS helps cells recover from glucose-phosphate stress by base pairing with ptsG mRNA (encoding the glucose transporter) and causing its degradation in an RNase E dependent manner. Base pairing between SgrS and ptsG mRNA also requires Hfq, an RNA chaperone frequently required by small RNAs that affect their targets through base pairing. The sgrS binding site is on the ptsG, which can let sgrS small RNA binds on it. false false _2478_ 32276 32276 9 false no false Po-Ying Huang annotation2505692 1 sgrS binding site range2505692 1 1 255 BBa_K2011000_sequence 1 ataaataaagggcgcttagatgccctgtacacggcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagcacccatactcaggagcactctcaattatgtttaagaatgcatttgctaacctgcaaaaggtcggtaaatcgctgatgctgccggtatccgtactgcctatcgcaggtattctgctgggcgtcggttccgcgaatttcagctggctgcccgccgttgtatcgcatgttatggcagaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z