BBa_K2012000 1 BBa_K2012000 c-di-GMP tandem riboswitche bc3-5 2016-08-04T11:00:00Z 2016-10-09T01:16:18Z From Bacillus thuringiensis subsp. chinensis CT-43 In the CT-43 genome19,20 (GenBank accession: NC_017208.1), five type I c-di-GMP riboswitches named Bc1, Bc2, Bc3, Bc4 and Bc5 RNA (Supplementary Tables S1???S5) were annotated in the Rfam database (http://rfam.sanger.ac.uk/search). Zhou, H., et al. (2016). "Characterization of a natural triple-tandem c-di-GMP riboswitch and application of the riboswitch-based dual-fluorescence reporter." Sci Rep 6: 20871. Three complete c-di-GMP riboswitches (Bc3, Bc4 and Bc5 RNA) with similar structures, which are arranged in tandem to constitute a triple-tandem (Bc3-5 RNA) riboswitch in the 5′-UTR of the cspABCDE mRNA in Bacillus thuringiensis subsp. chinensis CT-43. false false _2479_ 25212 25212 9 false We designed the sequence of bc3-5 by add perfix and suffix which are belong to BioBrick RFC 10. false Pan Chu BBa_K2012000_sequence 1 ccacgataaataaatacctatttttggcacactattcgaaaggataggtcgcaaagctaagagtctaaagtaatgaaaattactatgatagtctggttgcagtttggattttcacacatagttgtatgtatgaaaatcgaagaggcaaccggattttttattgtctcaaaaagaaaaaataaatgggcacactattcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccagattttttattgtctcaaaaagaaaaaataaatgggcacactgttcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccaggctttttattttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z