BBa_K2012010 1 BBa_K2012010 c-di-GMP tandem riboswitche bc5 2016-09-14T11:00:00Z 2016-09-15T12:00:03Z In the CT-43 genome(GenBank accession: NC_017208.1), five type I c-di-GMP riboswitches named Bc1, Bc2, Bc3, Bc4 and Bc5 RNAwere annotated in the Rfam database (http://rfam.sanger.ac.uk/search)42. While Bc1 and Bc2 are widely distributed in the B. cereus group4, Bc3, Bc4, and Bc5are connected in triple-tandem and only located in the 5′ -UTR of the cspABCDE mRNA in some B. cereus and B. thuringiensis Three complete c-di-GMP riboswitches (Bc3, Bc4 and Bc5 RNA) with similar structures, which are arranged in tandem to constitute a triple-tandem (Bc3-5 RNA) riboswitch in the 5′-UTR of the cspABCDE mRNA in Bacillus thuringiensis subsp. chinensis CT-43. Bc3, Bc4 and Bc5 exhibit very high sequence similarities (Fig. 1). Secondary structure predictions by Mfold (http://mfold.rna.albany.edu/?q= mfold) shows that Bc3, Bc4 and Bc5 share conservative stem-loops and c-di-GMP binding sites similar to Vc2 RNA. false false _2479_ 25212 25212 9 false The bc3 riboswitch is apart of the tandem riboswitch bc3-5. We analysed the sequence of bc3-5 and its scendary structure, found linkers between three complete riboswitches. Using PCR amplify the bc3 sequence which is similar with bc4 and bc5 with prefix and suffix, whereas the secondary structure of bc5 is different from other riboswitches'. false Pan Chu BBa_K2012010_sequence 1 aaaataaatgggcacactgttcgaaaggataggtcgcaaagctaagagtctaaggtaatgaaaattactatgatagtctggttgcagtttggattttcacacatgttgtgatgtatgaaaatcgaaaaggcaaccaggctttttatttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z