BBa_K2012015 1 BBa_K2012015 PcpcG2-172, a modified PcpcG2 promoter 2016-10-05T11:00:00Z 2016-10-06T09:50:48Z pJT119 plasmid PcpcG2 promoter is a 238bp green-light activated promoter in Synechocystis PCC 6803(Part:BBa_K592003). The full length promoter is comprised of a G-box region, a CcaR-P activated promoter, and a constitutive promoter, which contributes to the leakiness under red light and low dynamic range. Therefore, we constructed PcpcG2-172, a 172bp truncated cpcG2 promoter deleted for the constitutive promoter. false false _2479_ 32928 32928 9 false false Boyao Zhang annotation2486767 1 G-Box range2486767 1 105 126 annotation2486784 1 PcpcG2-172 range2486784 1 1 172 BBa_K2012015_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z