BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2012023 1 BBa_K2012023 PcpcG2-B0034-sfGFP 2016-10-06T11:00:00Z 2016-10-07T03:20:25Z sfGFP Generator from pJT119b original plasmid of Tabor's lab. sfGFP Generator from pJT119b original plasmid. false false _2479_ 27364 27364 9 false PcpcG2-B0034-sfGFP false Jun Li component2486842 1 BBa_K566009 component2486844 1 BBa_B0034 annotation2486844 1 BBa_B0034 range2486844 1 249 260 annotation2486842 1 BBa_K566009 range2486842 1 1 240 BBa_K566009 1 pCpcG2 inv pCpcG2 promoter, inverted sequence (Green light inducible) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was obtained from pJT122 plasmid of Dr. Jeff Tabor, but it was synthesized. pCpcG2 promoter (inverted sequence) from pJT122 plasmid of Dr. Jeff Tabor. This promoter is inducible with green light through ccaR and ccaS photoreceptor system. false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, no sites were found. false Daniel Rodriguez annotation2142152 1 pCpcG2 promoter range2142152 1 1 240 BBa_B0034_sequence 1 aaagaggagaaa BBa_K566009_sequence 1 agagcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct BBa_K2012023_sequence 1 agagcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatcttactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z