BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2012015 1 BBa_K2012015 PcpcG2-172, a modified PcpcG2 promoter 2016-10-05T11:00:00Z 2016-10-06T09:50:48Z pJT119 plasmid PcpcG2 promoter is a 238bp green-light activated promoter in Synechocystis PCC 6803(Part:BBa_K592003). The full length promoter is comprised of a G-box region, a CcaR-P activated promoter, and a constitutive promoter, which contributes to the leakiness under red light and low dynamic range. Therefore, we constructed PcpcG2-172, a 172bp truncated cpcG2 promoter deleted for the constitutive promoter. false false _2479_ 32928 32928 9 false false Boyao Zhang annotation2486784 1 PcpcG2-172 range2486784 1 1 172 annotation2486767 1 G-Box range2486767 1 105 126 BBa_K2012025 1 BBa_K2012025 PcpcG2-172-B0034-sfGFP 2016-10-06T11:00:00Z 2016-10-07T03:49:26Z sfGFP Generator from pJT119b original plasmid. sfGFP Generator from pJT119b original plasmid. false false _2479_ 27364 27364 9 false PcpcG2-172-B0034-sfGFP false Jun Li component2486867 1 BBa_B0034 component2486865 1 BBa_K2012015 annotation2486867 1 BBa_B0034 range2486867 1 181 192 annotation2486865 1 BBa_K2012015 range2486865 1 1 172 BBa_K2012025_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K2012015_sequence 1 agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z